We narrowed to 11,271 results for: cat.1
-
Plasmid#227542PurposeLevel 1 - Position 1 with 35S promoter and terminator for plant expressionDepositorInsert35Sshort_TMV_CaTXSS_35S
ExpressionPlantMutationBsaI sites removed by silent mutationPromoter35Sshort_TMV (pICH51277)Available SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-2
Plasmid#52378Purposeexpresses human Syndecan-1 GAGAL replaced with GADEV of SDC2 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationGAGAL of syndecan-1 replaced with of GADED of SDC…PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-4
Plasmid#52375Purposeexpresses human Syndecan-1 GAGAL replaced with GDLDD of SDC4 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationGAGAL of syndecan-1 replaced with GDLDD of SDC4; …PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP PR-D25A
Plasmid#101334PurposepBS NL4-3 envFS eGFP with mutation that disrupts Protease catalytic activityDepositorInsertNL4-3 envFS
UseLentiviralMutationProtease D25AAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP RT-D185K/D186L
Plasmid#101332PurposepBS NL4-3 envFS eGFP with mutation that disrupts RT catalytic activityDepositorInsertNL4-3 envFS
UseLentiviralMutationreverse transcriptase D185K/D186LAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAtCHYb1Δ129N
Plasmid#53367PurposeContains a truncated Arabidopsis beta-carotene hydroxylase cDNA, the product of which converts beta-carotene primarily to monocyclic beta-cryptoxanthin in E. coli. Use with pAC-BETA or pAC-BETAipi.DepositorInsertchyB1 (BETA-OHASE 1 Mustard Weed)
ExpressionBacterialMutationDeleted codons for the first 129 amino acidsPromoterTrcAvailable SinceApril 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pCEP4-BG505.SOSIP-QES.i03.c01-8his
Plasmid#111846PurposeMammalian expression plasmid for soluble BG505 SOSIP.664; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
Tags8his purification tag and CD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4K16Q-Halo-FRT
Plasmid#247458PurposeExpresses wild-type H4K16Q-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4K16R-Halo-FRT
Plasmid#247457PurposeExpresses wild-type H4K16R-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4-HaloTag-FRT
Plasmid#247452PurposeExpresses wild-type H4-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4K16A-Halo-FRT
Plasmid#247459PurposeExpresses wild-type H4K16A-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(T59/T61A)(HA)
Plasmid#195025PurposeGateway vector containing HA-tagged Creb5 with T59/T61A mutationDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61A mutation) (CREB5 Bovine)
UseGateway cloningTags3xHAMutationT59/T61AAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(T59/T61D)(HA)
Plasmid#195026PurposeGateway vector containing HA-tagged Creb5 with T59/T61D mutationDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61D mutation) (CREB5 Bovine)
UseGateway cloningTags3xHAMutationT59/T61DAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK-CMV-hNHERF2
Plasmid#47801PurposeExpresses human NHERF2 in mammalian cellsDepositorAvailable SinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTXB1.Tat(48-57)-Cre recombinase
Plasmid#165042PurposeExpression of Tat(48-57) conjugated Cre recombinase for protein purification (Intein-chitin binding domain fussion)DepositorInsertCre recombinase
TagsMxe Intein-Chitin binding domain and Tat(48-57)ExpressionBacterialAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKPI-MtLAP1
Plasmid#193521PurposeAnthocyanin pigmentation based visual marker for arbuscular mycorrhizal fungal colonization of Medicago truncatula rootsDepositorInsertsMtLAP1
DsRed
ExpressionPlantPromoterATUBI10 and Medtr8g059790(KPI)Available SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
KSP_K560GFP
Plasmid#129770PurposeExpresses Xenopus Kinesin-5 KSP head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKSP (kif11.L Frog)
TagsGFP and His6ExpressionBacterialMutationTruncation at 367, fused to kinesin-1 starting Al…Available SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only