We narrowed to 8,876 results for: sgrna
-
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_1
Plasmid#68807Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.DepositorInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-MiSgRNA_PuroR
Plasmid#84781PurposeExpresses minor satellite-specific sgRNA.DepositorInsertminor satellite-specific sgRNA
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-trmI
Plasmid#89955PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting trmI.DepositorInserttrmI gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pfkB
Plasmid#102284PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting pfkB.DepositorInsertpfkB gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-xylA
Plasmid#89964PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting xylA.DepositorInsertxylA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-lpoB
Plasmid#89959PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.DepositorInsertlpoB gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_3
Plasmid#73527PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_4
Plasmid#73528PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_2
Plasmid#73526PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_4
Plasmid#242899PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B0_M13ps
Plasmid#231421PurposeM13 phagemid constitutively expressing sgRNA-B0. sgRNA-B0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ552.)DepositorInsertsgRNA-B0
UseSynthetic BiologyAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B1_M13ps
Plasmid#231422PurposeM13 phagemid that expresses sgRNA-B1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ615.)DepositorInsertsgRNA-B1
UseSynthetic BiologyAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX330-sgRNA006_CTCF
Plasmid#232928PurposeExpression vector for a sgRNA against the mouse CTCF locus and SpCas9.DepositorAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA047_Podxl
Plasmid#232932PurposeExpression vector for a sgRNA against the mouse Podxl locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Podxl S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-1pro
Plasmid#231151PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbATML1-1proDepositorInsertmobile gRNA targeting NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C1_M13ps
Plasmid#231411PurposeM13 phagemid that expresses sgRNA-C1 (= sgRNA A5T from Nielsen et al., 2014) from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ272.)DepositorInsertsgRNA-C1
UseSynthetic BiologyAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PE-pegRNA(BG)-nsgRNA(BG)
Plasmid#232727PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).DepositorInsertpegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-2_M13ps
Plasmid#231412PurposeM13 phagemid that expresses sgRNA-2 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ171.)DepositorInsertsgRNA-2
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A0_M13ps
Plasmid#231413PurposeM13 phagemid constitutively expressing sgRNA-A0. sgRNA-A0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI).DepositorInsertsgRNA-A0
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_LacI_pLac-sgRNA-1
Plasmid#231408PurposesgRNA-1 expression from an IPTG-inducible promoter.DepositorInsertssgRNA-1
LacI
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_AraC_pBAD-sgRNA-1
Plasmid#231407PurposesgRNA-1 expression from an arabinose-inducible promoter.DepositorInsertssgRNA-1
AraC
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A1_M13ps
Plasmid#231414PurposeM13 phagemid that expresses sgRNA-A1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ164.)DepositorInsertsgRNA-A1
Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C0_M13ps
Plasmid#231410PurposeM13 phagemid constitutively expressing sgRNA-C0. sgRNA-C0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ156.)DepositorInsertsgRNA-C0
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-1_M13ps
Plasmid#231409PurposeM13 phagemid that expresses sgRNA-1 from a strong constitutive promoter.DepositorInsertsgRNA-1
UseSynthetic BiologyAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA_MET_uORF1
Plasmid#216537PurposegRNA and template for MET 5'UTR uORF1 mutationDepositorInsertpegRNA MET 5'UTR uORF1 mutation
ExpressionMammalianAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA_MET_uORF2
Plasmid#216538PurposegRNA and template for MET 5'UTR uORF2 mutationDepositorInsertpegRNA MET 5'UTR uORF2 mutation
ExpressionMammalianAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
p103DestTol2pA2-4xU6sgRNA
Plasmid#227778PurposeDestination vector with U6 driven 4 sgRNAsDepositorInsert4xU6:sgRNA
UseCRISPRPromoterU6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_Cas9-hGem_Smc4
Plasmid#217667Purposeexpresses Cas9-hGem and guideRNA for tagging of SMC4DepositorInsertsgRNA1 targeting SMC4 C-terminal (SMC4 Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr3
Plasmid#193660PurposeExpression of tandem pre-sgRNA array hcr3 for LbCas12aDepositorInsertU6-CFTR-sgRNA-KLF4-sgRNA-TET1-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr5
Plasmid#193661PurposeExpression of tandem pre-sgRNA array hcr5 for LbCas12aDepositorInsertU6-DNMT3B-sgRNA-KLF4-sgRNA-TET1-sgRNA-PRR5L-sgRNA-CFTR-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only