We narrowed to 2,547 results for: gcg
-
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPB
Plasmid#164989PurposeExpression of gRNA targeting HLA-DPB locus, including DPB1*01:01:01DepositorInsertgRNA against HLA-DPB1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
gh144
Plasmid#106803Purposeexpression of gRNA targeting LARGEDepositorInsertLARGE
ExpressionMammalianAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
MLSE-shRPA3.457
Plasmid#105584Purposeretrovirally express RPA3 shRNA with GFP markerDepositorInsertRPA3 shRNA #457
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-frame_selector_0,1,2
Plasmid#131152PurposeDrosophila expression of frame selector sgRNAs 0,1, and 2 that target the CRISPaint site for homology-independent knock-inDepositorInsertCRISPaint frame selector sgRNAs 0,1,2
UseCRISPRExpressionInsectPromoterdU6:3Available SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBB75-ncRNA
Plasmid#194087PurposeExpresses Ec86 ncRNA in Escherichia coliDepositorInsertEc86 ncRNA
PromoterT7Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
1161F
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pW318-lenti-sg2-mmItga9-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189948PurposeLentiviral vector to co-express a mouse Itga9 spsgRNA (sg2-Itga9) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itga9 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW319-lenti-sg3-mmItga9-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189949PurposeLentiviral vector to co-express a mouse Itga9 spsgRNA (sg3-Itga9) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itga9 spsgRNA #3
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-mfn2 guide
Plasmid#121993PurposeAn entry vector with U6a and U6c promoter driving mfn2 guide RNAs expressionDepositorInsertmfn2 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-