229,387 results
-
Plasmid#107227PurposeAnti-mouse CD19 CAR with CD3 ITAMs mutatedDepositorInsert1D3-28Z. 1-3 mut
UseRetroviralTagsNoneMutationNoneAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
MORF Library Kit with GFP and mCherry controls
Pooled Library#1000000218DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
EJ2GFP-puro
Plasmid#44025DepositorInsertEJ2GFP egfp-based chromosomal break reporter
ExpressionMammalianMutationinsertion of I-SceI, 3 frame stop, and flanking m…PromoterpCAGGSAvailable SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1
Plasmid#54767PurposeLocalization: N1 Cloning Vector, Excitation: 488, Emission: 507DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsmEGFPExpressionMammalianAvailable SinceJune 20, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLX301
Plasmid#25895Purpose3rd generation lentiviral Gateway destination vector. Puromycin selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vectorExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV PHP.eB)
Viral Prep#44361-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with the PHP.eB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCL-Eco
Plasmid#12371DepositorInsertgag/pol/env
UseRetroviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only