We narrowed to 8,785 results for: sgrna
-
Plasmid#220906PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PG-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840APromoterAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide2 in pX458
Plasmid#211536PurposesgRNA-2 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide1 in pX458
Plasmid#211535PurposesgRNA-1 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRTagsExpressionMutationPromoterAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralTagsExpressionMutationPromoterAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF496_dpy-10_CDS_sg6
Plasmid#164267PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRTagsExpressionWormMutationPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF495_dpy-10_CDS_sg6
Plasmid#164268PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJF439.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRTagsExpressionWormMutationPromoterU6 promoter from W05B2.8Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF449_dpy-10_CDS_sg1
Plasmid#163866PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRTagsExpressionWormMutationPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF328_sqt-3_3′UTR_sg2
Plasmid#163867PurposesgRNA targeting sqt-3 (3′UTR) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the 3'UTR of sqt-3
UseCRISPRTagsExpressionWormMutationPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
UseTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_045
Plasmid#107144Purposecloning of a sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorHas ServiceCloning Grade DNAInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1201
Plasmid#92144PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locusDepositorInsertspCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-EbpA_g1
Plasmid#153517PurposesgRNA for ebpA gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertpnisA-sgRNA(EbpA_g1)-dCas9 scaffold
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only