We narrowed to 1,236 results for: poli
-
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSP2N2
Plasmid#29520DepositorInsertMSP2N2
Tags7-His tagExpressionBacterialMutationtandem MSP; His-tag on N-terminus followed by spa…Available SinceMay 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET32a-Nb11-P2
Plasmid#236499PurposeExpresses anti-Apolipoprotein A1 nanobody Nb11 as a fusion protein with coiled coil P2 in bacteria.DepositorInsertNb11-P2
ExpressionBacterialAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pBAD24-sfGFPx2
Plasmid#51559PurposeSuperfolder GFP ORF cloned into pBAD24 for expression in E. coli. It contains additional aminoacids in the N and C terminus (polilinker sequences for cloning proteins in frame with GFP)DepositorInsertsuperfolder GFP
TagsGLESTCRHASLAVLADERRFSA and MARARAExpressionBacterialMutationContains additonal aa in the N and C terminus (in…Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFS462
Plasmid#89065Purposehis7 integration plasmid with Z3EVpr:GFPDepositorInsertZ3EV promoter GFP-NLS leu1 C-terminal 300 nt
UseS. pombe his7 integration vectorPromoterZ3EVAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBEAST_J23101-amidase
Plasmid#128135PurposeThe cell-free adapted backbone, pBEAST, expressing the amidase enzyme gene (benzamid to benzoate) under control of the constitutive promoter J23101, and RBS B0032DepositorInsertamidase
UseSynthetic BiologyExpressionBacterialPromoterJ23101Available SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1
Plasmid#112858Purposeplasmid for expression of rat APOBEC1 in mammalian cellsDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1 E63A
Plasmid#112861Purposeplasmid for expression of a catalytically inactive rat APOBEC1 mutant in mammalian cellsDepositorArticleInsertAPOBEC1 (Apobec1 Rat)
ExpressionMammalianMutationchanged Glutamic acid 63 to AlaninePromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only