We narrowed to 15,328 results for: EGF
-
Plasmid#40034DepositorInserthSlp4-a SHD (SYTL4 Human)
TagsEGFPExpressionMammalianMutationSHD domain (1-143)PromoterCMV promoterAvailable SinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-STAG2-D299A
Plasmid#31975DepositorInserthuman STAG2 cDNA (STAG2 Human)
TagsEGFP and FLAGExpressionMammalianMutationchanged Aspartic acid 299 to AlanineAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAG304GAL-EGFP-ccdB
Plasmid#14303DepositorTypeEmpty backboneUseGateway CloningTagsEGFPExpressionYeastAvailable SinceJune 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa2-EGFP
Plasmid#254429PurposeFor production of AAV containing EGFPDepositorInsertGreen Fluorescent Protein
UseAAVPromoterGfa2Available SinceMay 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_PA-mEGFP-Tau
Plasmid#255810Purposemammalian expression of Tau tagged with PA and mEGFPDepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAVS-EGFP^PTC-35
Plasmid#254990PurposeExpress EGFP^PTC-35 in mammalian cellsDepositorInsertEGFP^PTC-35
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
tetOFF-EGFP^PTC-35
Plasmid#254992PurposeExpress doxycycline-repressive EGFP^PTC-35 in mammalian cellsDepositorInsertEGFP^PTC-35
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PolB (pc2455)
Plasmid#247055PurposeExpresses GFP-tagged human PolB1 in mammalian cellsDepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pN1_FV-NUP62-EGFP3
Plasmid#252747PurposeExpression of NUP62 with three tandem EGFPs. FV is a modified FKBP domain (aka DmrB) whose dimerization is induced by addition of Rapalog2. Blocks nulcear pore in absence of Rapalog2.DepositorAvailable SinceApril 3, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
ER-EGFP-FLAG-APEX2
Plasmid#251714PurposeExpresses ER localized EGFP-FLAG-APEX2 in mammalian cellsDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hVEGFR3-mTurquoise
Plasmid#250335PurposeExpression of the human VEGFR3 tagged with C-terminal mTurquoise tagDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pN1_Rev-GR(m10)-EGFP
Plasmid#252751PurposeControl for studying nuclear export. Expression of a fusion protein containing full-length Rev, the hormone-responsive element of the rat Gr, and GFP. The m10 mutation abolishes nuclear export.DepositorInsertHIV-1 Rev and Glucocorticoid Receptor (GR)
TagsEGFPExpressionMammalianMutationm10 is mutation of nuclear export sequenceAvailable SinceMarch 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-eGFP-T7
Plasmid#242778PurposeAAV transfer plasmid expressing eGFP-T7 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsT7PromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/Integrin-b3-Halo
Plasmid#249172PurposeMammalian expression vector of human ITGB3 fused with Halo-tagDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS
Plasmid#221867PurposeEmpty backbone for expressing GFP-fusion proteins in mammalian cells with a nuclear localization signal (NLS).DepositorTypeEmpty backboneTagsEGFPExpressionMammalianAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-myo1e-tail
Plasmid#248919PurposeExpresses EGFP-tagged human myosin 1e tail (aa 710-1109) in mammalian cellsDepositorInsertMyo1e tail (MYO1E Human)
TagsEGFPExpressionMammalianMutationcontains only amino acids 710 to the endPromoterCMVAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-AAK1-Ser624Ala
Plasmid#237899PurposeExpression of GFP-AAK1 in mammalian cellsDepositorInsertAP2-associated protein kinase 1 (AAK1 Human)
TagsGFPExpressionMammalianMutationSerine 624 changed to alaninePromoterCMVAvailable SinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-AAK1-Ser624Asp
Plasmid#238069PurposeExpression of GFP-AAK1 in mammalian cellsDepositorInsertAP2-associated protein kinase 1 (AAK1 Human)
TagsGFPExpressionMammalianMutationSerine 624 changed to aspartateAvailable SinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
2X-FKBP-meGFP-OMP25mts
Plasmid#228545PurposeFKBP domain targeted to the mitochondrial OMM. Use for rapalog CID systemDepositorInsert2xFKBP--mito-meGFP
ExpressionMammalianAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/YAP-mScarlet3-H
Plasmid#249171PurposeMammalian expression vector of YAP fused with mScarlet3-HDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRSET-IRES-EGFP
Plasmid#216151PurposeDonor of EMCV IRES for the preparation of other plasmids.DepositorInsertsEMCV IRES
EGFP
UseSynthetic Biology; Mrna preparationAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-mEGFP-Rab8a
Plasmid#246270PurposeRab8 sensor donorDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
INS-IRES-EGFP
Plasmid#214021PurposeGFP fluorescent reporter for insulin gene expression. IRES-EGFP and PuroR with homology arms for human insulin gene.DepositorInsertEGFP
Available SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW-EGFP-mPkm2
Plasmid#242812PurposeLentiviral vector expressing mouse Pkm2 tagged with an N-terminal EGFPDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(ylt1)
Plasmid#246662PurposeMammalian expression of mutant, eGFP tagged DNAJC13DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationMutated 2206-Y 2207-L 2208-T to AlaninesPromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(hpd)
Plasmid#246663PurposeMammalian expression of DnaJ domain mutant, eGFP tagged DNAJC13DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationMutated 1332-H, 1333-P, 1334-D to AlaninesPromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(2198t)
Plasmid#246661PurposeMammalian expression of truncated, eGFP tagged DNAJC13DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationDeletion of residues 2199 to 2243 (c-terminal res…PromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(351t)
Plasmid#246666PurposeMammalian expression of truncated, eGFP tagged DNAJC13 (PH-like domain only)DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationDeletion of residues 352 to 2243PromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-Serbp1-meGFP
Plasmid#241316Purposemouse Serbp1 fused to meGFP for expression in mammalian cellsDepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only