We narrowed to 8,392 results for: crispr grnas
-
Plasmid#140588PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA VEGFA
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-ALDH1A3
Plasmid#140589PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA ALDH1A3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-SYNPO
Plasmid#140587PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA SYNPO
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-TTLL11
Plasmid#140582PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA TTLL11
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CLIC3
Plasmid#140583PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CLIC3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna2-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128337PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna4-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128339PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna7-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128342PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo3/Cre
Plasmid#89653PurposeExpresses a Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Neomycin
UseCre/Lox and LentiviralExpressionMammalianAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 1 GAPDH
Plasmid#83808PurposeExpress Sg-1 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_G3BP1_G1
Plasmid#127114DepositorInsertgRNA G3BP1 (G3BP1 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTargetF-FRT
Plasmid#113637PurposeDerivative of pTargetF with gRNA targeting FRT siteDepositorInsertsgRNA-FRT
UseCRISPRPromoterpJ23119Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pADH100-2
Plasmid#90981PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH99 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, FRT, DS_HIS1
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN022
Plasmid#91668PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN217
Plasmid#91676PurposeExpress sgRNA targeting human TLE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G0-R0
Plasmid#101803PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-ACTA2_gRNA1-SpCas9-T2A-GFP
Plasmid#126706Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertACTA2_gRNA1-SpCas9-T2A-GF (ACTA2 Human)
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA p53, mitfa:Cas9
Plasmid#118841PurposeTargets tp53 and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInserttp53 gRNA (tp53 Zebrafish)
UseCRISPR; Tol2Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only