We narrowed to 9,052 results for: sgRNA
-
Plasmid#236042PurposeThe plasmid pQdCas12a.sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
p1071-Lenti-Single loxP
Plasmid#217892PurposeLentiviral vector, entry vector for Lentiviral Switch-OVERDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8823
Plasmid#220901PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (mscar targeting), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8930
Plasmid#220905PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PC-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3'UTR-Tetra-com-vector
Plasmid#132553PurposeExpresses spCas9 and sgRNA scaffold with com aptamer replacing the TetraloopDepositorInsertsCas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
Plasmid#172225PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI2
Plasmid#111593PurposemU6-sgRNA GI Library vectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC523
Plasmid#62320PurposesgRNA for yeast cellsDepositorInsertsgRNA
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI3
Plasmid#111594PurposehU6-sgRNA GI Library vectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_NANOG_bKO
Plasmid#172224PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the telomeric human NANOG CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
SGL40C.EFS.RFP657
Plasmid#69147PurposeAdvanced lentiviral Vector for sgRNA (hU6 Promoter) delivery with RFP657 expression (EFS Promoter)DepositorInsertssgRNA
EFS
tagRFP657
Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7
Plasmid#173204PurposeExpresses the ATP1A1 G7 sgRNA in combination with SpCas9 to target ATP1A1 intron 17.DepositorInsertATP1A1 G7 sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK413
Plasmid#155372PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus] (sgRNAs flip of 412)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
EDCPV PCSK5_sg09
Plasmid#232455PurposeLentiviral, CRISPR sgRNA for PCSK5DepositorInsertPCSK5 sgRNA (PCSK5 Human)
UseCRISPR and LentiviralAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKO024.306-107
Plasmid#242927PurposeExpression of a Sth1-dCas9 compatible MS2 scRNA J306 and a Spy-dCas9 compatible sgRNA J107DepositorInsertsgRNA J107
UseCRISPR and Synthetic BiologyPromoterBba_J23119Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Scramble_gRNA_puro
Plasmid#234999Purposescramble sgRNADepositorInsertscramble sgRNA
UseLentiviralTagsEGFP:T2A:PuroExpressionMammalianAvailable SinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only