We narrowed to 15,154 results for: GRN
-
Plasmid#80258Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145885)
Plasmid#80196Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
Plasmid#166693PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.DepositorInsertsdCas9-VPR
3x Cnga1 promoter-targeting sgRNAs
UseCRISPRExpressionMammalianPromoterTRE and U6Available SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1α-sakkhCas9-HA-NLS-polyA-CBh-EGFP-polyA
Plasmid#168305Purposemediated knock-in of sgRNA precursorDepositorInsertSaKKH-EGFP-U6-sgRNA
UseAAVExpressionMammalianPromoterEF1alpha, CBhAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-NC1
Plasmid#248557PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA-NC1 TD#277
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3241 PB-AtoBpegRNA-mCherry
Plasmid#226666PurposePiggyBac cargo vector encoding A to B pegRNA marked with mCherryDepositorInsertAtoB pegRNA
UseCRISPRExpressionMammalianAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCherry U6-sgRNA (BsmBI)
Plasmid#214128PurposeMammalian continuous expressionDepositorInsertsgRNA
UseLentiviralExpressionMammalianMutationWTAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-POLQ-Halo
Plasmid#211636PurposesgRNA against POLQDepositorInsertsgRNA POLQ
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-CjCas9-MS2gRNA-Backbone
Plasmid#210711PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNADepositorInsertMS2 loop containing Cj Cas9 gRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrV_oxTi365.gRNA
Plasmid#194052PurposesgRNA targeting ChrV_oxTi365 locus of the C. elegans genomeDepositorInsertChrV_oxTi365 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-deGFP
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only