We narrowed to 9,039 results for: sgRNA
-
Plasmid#184145PurposesgRNA with 3 RNA aptemers BoxB at the 3'-end for CRISPRaDepositorInsertsgRNA-LEA2-ex3
UseSynthetic BiologyPromoterPlux2Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_728
Plasmid#176656PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039728) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Agam_557
Plasmid#176667PurposeExpression of sgRNA under An. gambiae U6-1 (AGAP013557) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_972
Plasmid#176674PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL028972) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Agam_557
Plasmid#176653PurposeExpression of sgRNA under An. gambiae U6-1 (AGAP013557) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aalb_726
Plasmid#176675PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029726) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_763
Plasmid#176672PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017763) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_972
Plasmid#176660PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL028972) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_801
Plasmid#176657PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039801) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_801
Plasmid#176671PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039801) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_728
Plasmid#176670PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039728) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKH-1699
Plasmid#124227PurposeMammalian SpCas9-HF1 expressionDepositorInsertSpCas9-HF1
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targetiā¦PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-2
Plasmid#86135PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorInsertsgRNA targeting C17orf89 (NDUFAF8 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-3
Plasmid#86136PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-1
Plasmid#86137PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only