169,450 results
-
Plasmid#90370PurposeTFEB - Lysosomal biogenesis gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterTFEBAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS2
Plasmid#46954PurposeCloning plasmid for the generation of Knock-In in human cells using rAAV.DepositorTypeEmpty backboneUseAAVAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-v2.1
Plasmid#167981PurposeExpresses CRISPRoff-v2.1 (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-BFP-KRAB) downstream of the CAG promoterDepositorInsertCRISPRoff-v2.1 (DNMT3A-DNMT3L-dCas9-BFP-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and tagBFPExpressionMammalianPromoterCAGAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Puro (658-5)
Plasmid#17448Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, PuroDepositorHas ServiceCloning Grade DNAInsertGFP
UseLentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro
Pooled Library#73178PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FLII12Pglu-700uDelta6
Plasmid#17866DepositorInsertFLII12Pglu-700uDelta6
TagsCitrineExpressionMammalianMutation700uDelta6, ECFP insert in mglBAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
35S-VP16-GWY/pAM
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MMLVgag-D3A-3L-dCas9-ZIM3
Plasmid#240531PurposeExpresses MMLVgag–DNMT3A-3L-dCas9-ZIM3 for producing RENDER-DNMT3A-3L-dCas9-ZIM3DepositorInsertMMLVgag-D3A-3L-dCas9-ZIM3
TagsFLAG, HAExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-GAL4BD/pAM
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
phMYT1L-N174
Plasmid#66809Purpose2nd generation lentiviral transfer plasmid. Expresses human MYT1L with G418 resistanceDepositorAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast
Plasmid#61425Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)DepositorHas ServiceLentiviral PrepInsertdCAS9(D10A, N863A)-VP64_2A_Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSynapsin_psychLight2 (AAV9)
Viral Prep#163909-AAV9PurposeReady-to-use AAV9 particles produced from pAAV_hSynapsin_psychLight2 (#163909). In addition to the viral particles, you will also receive purified pAAV_hSynapsin_psychLight2 plasmid DNA. Synapsin-driven expression of the genetically encoded fluorescent sensor psychLight2 to detect behaviorally relevant serotonin release. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-puro
Plasmid#45567DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsIRES-EGFP-PuroExpressionMammalianPromoterPhcmv (strong human cytomegalovirus immediate ear…Available SinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only