We narrowed to 9,861 results for: plasmids 101
-
Plasmid#65770PurposeBacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNADepositorInsertmammalian codon-optimized SaCas9, and SaCas9 gRNA
UseCRISPRTagsNLS-3xFlagExpressionBacterialMutationPromoterT7 (x2)Available sinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
L0I101- GG4-pGATA23-Bxb1-tUBQ10-GG6
Plasmid#219712PurposeLevel 0 pGATA23-Bxb1-tUBQ10 construct for assembly of two integrase constructs, GG4 and GG6 BsaI sites.DepositorInsertGG4-pGATA23-Bxb1-tUBQ10-GG6
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg5-del847-1017-siRNAres_I
Plasmid#146540PurposeMammalian Expression of HsSmg5-del847-1017-siRNAresDepositorInsertHsSmg5-del847-1017-siRNAres (SMG5 Human)
UseTagsExpressionMammalianMutationthree non silent mutation A254G (K85R), T980C (L3…PromoterAvailable sinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
KJ101: pMVP (R4-R3) osTir1
Plasmid#121742PurposepMVP R4-R3 entry plasmid, contains osTir1 for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertosTir1
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc epitope tagExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTS1018-Tier1-PhCMV-p2A
Plasmid#169491PurposeTier-1 vector encoding a self-cleaving peptides p2a sequence (PhCMV-p2A-pA).DepositorInsertPCMV-driven 2A sequence of porcine teschovirus-1
UseTagsExpressionMammalianMutationPromoterPhCMVAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pGS101_EGFP(A206K)-CENP-T(1-242) AAVS donor
Plasmid#211867PurposeCENP-T(1-242) transgene integration at AAVS1 safe harbor locusDepositorInsertCENP-T(1-242) (CENPT Human, Synthetic)
UseCRISPRTagsExpressionMutationN/APromoterAvailable sinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_AR-RE_MLPmin_BC1011-luc2
Plasmid#227106PurposeAndrogen receptor response element for luciferase and barcode assays; barcode BC1011DepositorInsert8x clustered AR response element linked to MLP minimal promoter driving barcode 1011 and a luciferase reporter gene
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_AR-RE_MLPmin_BC1014-luc2
Plasmid#227108PurposeAndrogen receptor response element for luciferase and barcode assays; barcode BC1014DepositorInsert8x clustered AR response element linked to MLP minimal promoter driving barcode 1014 and a luciferase reporter gene
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_AR-RE_MLPmin_BC1013-luc2
Plasmid#227107PurposeAndrogen receptor response element for luciferase and barcode assays; barcode BC1013DepositorInsert8x clustered AR response element linked to MLP minimal promoter driving barcode 1013 and a luciferase reporter gene
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
IF101: pMVP (L1-L4) EF1a promoter
Plasmid#121687PurposepMVP L1-L4 entry plasmid, contains EF1a promoter for 3-component MultiSite Gateway Pro assemblyDepositorInsertEF1a promoter
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IG101: pMVP (L5-L4) TRE promoter
Plasmid#121729PurposepMVP L5-L4 entry plasmid, contains TRE promoter for 4-component MultiSite Gateway Pro assemblyDepositorInsertTRE promoter
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTS1017-Tier1-OTetO7-PCMVmin-SEAP
Plasmid#169586PurposeTier-1 vector encoding PTetO7-driven SEAP (OTetO7-PCMVmin-SEAP-pA).DepositorInserttetracycline-controlled SEAP expression
UseTagsExpressionMammalianMutationPromoterTetO7-PCMVminAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TNIK gRNA (BRDN0001146101)
Plasmid#75850Purpose3rd generation lentiviral gRNA plasmid targeting human TNIKDepositorInsertTNIK (TNIK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LD101: pMVP (L3-L2) eCFP + WPRE
Plasmid#121775PurposepMVP L3-L2 entry plasmid, contains eCFP + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eCFP fusion to gene of interest in lentivirus vectors.DepositorInserteCFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KP101: pMVP (L5-L4) Puro-P2A
Plasmid#121716PurposepMVP L5-L4 entry plasmid, contains Puro-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Puro selection marker linked by P2A to gene of interest.DepositorInsertPuro-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH6Z-101
Plasmid#85226PurposePlasmid clone containing HHV-6B(Z29) restriction endonuclease fragmentDepositorInsertfragment of the human herpesvirus 6B strain Z29 genome
UseCloning vectorTagsExpressionMutationPromoterAvailable sinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G2 gRNA (BRDN0001149101)
Plasmid#76989Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1G2DepositorInsertCSNK1G2 (CSNK1G2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only