We narrowed to 170,876 results for: addgene
-
Plasmid#241456PurposeDelete TMEM173 (STING)DepositorAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only
-
U1_snRNA_Weak_SS
Plasmid#249810PurposeMutated human U1 snRNA complementary to a weak 5' splice site sequence CAGgtacgaDepositorInsertMutated human U1 snRNA
ExpressionMammalianPromoterU1Available SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
HRPEadh-pAG303
Plasmid#249735PurposeDerived from pAG303GPD-ccdb (#14134); GPD replaced with a synthetic 5xHRPE-ADHutr sequence for orthogonal activation by plant RAP2.12-based TFs.DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
HRPEadh-pAG305
Plasmid#249734PurposeDerived from pAG305GPD-ccdb (#14138); GPD replaced with a synthetic 5xHRPE-ADHutr sequence for orthogonal activation by plant RAP2.12-based TFs.DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-XRN2_sgRNA_1
Plasmid#242895PurposePiggyBac cargo vector with XRN2 sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-XRN2_sgRNA_2
Plasmid#242896PurposePiggyBac cargo vector with XRN2 sgRNA 2 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLexM-HsPQLC1(Δ100-125/GGGS/Δ257-271)-TEV-GFP-His8
Plasmid#250427PurposeExpression of C-terminally TEV-GFP-His8 Tagged HsPQLC1 (Δ100-125 - with these residues replaced by a GGGS Linker; Δ257-271) in Mammalian CellsDepositorInsertPQLC1 (SLC66A2 Human)
TagsTEV-GFP-8xHisExpressionMammalianMutationΔ100-125 (Replaced with GGGS), Δ257-271PromoterChicken-beta-actin promoter/CMV EnhancerAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLexM-HsPQLC1(Δ100-125/3xGGGS/Δ257-271)-TEV-GFP-His8
Plasmid#250429PurposeExpression of C-terminally TEV-GFP-His8 Tagged HsPQLC1 (Δ100-125 - with these residues replaced by 3xGGGS Linker; Δ257-271) in Mammalian CellsDepositorInsertPQLC1 (SLC66A2 Human)
TagsTEV-GFP-8xHisExpressionMammalianMutationΔ100-125 (Replaced with 3xGGGS), Δ257-271PromoterChicken-beta-actin promoter/CMV EnhancerAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pB-Orthogonal_LTR5Hs_CARGO
Plasmid#248159PurposeEncodes a set of guide RNAs targeting LTR5Hs elements (orthogonal to Addgene #191316)DepositorInsertArray of guide RNAs
UseCRISPRTagsmCherryExpressionMammalianAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAG304-ccdbNLUC
Plasmid#249736PurposeDerived from pAG304GPD-ccdb (#14136); GPD removed and NLUC cds inserted downstream gateway cassette. Useful for cloning promoter-NLUC fusions in Saccharomyces cerevisiaeDepositorTypeEmpty backboneExpressionYeastAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 sgTMEM173_2
Plasmid#241457PurposeDelete TMEM173 (STING)DepositorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Blast LUC (w528-1)
Plasmid#235669PurposeLentiviral expression vector for Luciferase without v5 tagDepositorInsertFirefly Luciferase
UseLentiviralAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
p304N
Plasmid#246317PurposePlant CRISPR editing with the experimentally validated Medicago truncatula MtU6.6 promoter (352 bp)DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJP_Bla01
Plasmid#230982PurposeModified version of the pBLADE_ONLY_C (#168050). It expresses VVD-AraC, but the f1 ori was deleted and the chloramphenicol resistance gene was replaced by gentamicin resistance.DepositorInsertGentamicin resistance gene
ExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CNTL-sfGFP
Plasmid#240100PurposeSP6-GFP plasmidDepositorInsertsfGFP
ExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZB604_pT7-sfGFP
Plasmid#228510PurposeBacterial Hybrid Reporter Plasmid (sfGFP), pT7-sfGFPDepositorInsertsfGFP
UseSynthetic BiologyPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only