We narrowed to 10,582 results for: plasmids 101
-
Plasmid#137138PurposeIntersectional viral expression of oScarlet in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-sRGECO
Plasmid#137128PurposeIntersectional viral expression of sRGECO in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE217DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon/Von GCaMP 6m
Plasmid#137165PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND Flp AND VcreDepositorInsert3x-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationRemoved RSET tagPromoterEf1aAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-BFP
Plasmid#137130PurposeIntersectional viral expression of BFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-BFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-S-WPRE
Plasmid#127867PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP-S fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse, Human)
UseAAVTags3xFLAG and mCherryExpressionMutationconstructed by blunt end fusion of the 5’ 51 nucl…PromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-500-WPRE
Plasmid#174134PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-500 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-Flex/3'USS-hM4D/2A/GFP(ATG mut)
Plasmid#197892PurposeCan be used to generate AAV virus that will express hM4D/2A/GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInserthM4D/2A/GFP
UseAAVTagsExpressionMutationN/APromoterEF1aAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1 ATP2B1
Plasmid#60788PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and wild-type miR-155 sitesDepositorInsertATP2B1 3'UTR and wild-type miR-155 binding site (ATP2B1 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
R619-M68-303: CMV51p> TPAss-SARS-CoV-2 S-RBD(319-529)-3C-His8-SBP
Plasmid#166019Purposemammalian expression of SARS-CoV-2 spike receptor-binding domain (RBD) optimized for serologyDepositorAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIS1 LMBRD2
Plasmid#60800PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and wild-type miR-155 sitesDepositorInsertLMBRD2 3'UTR and wild-type miR-155 binding site (LMBRD2 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-4
Plasmid#133404Purposehuman ETV6 gRNA-3 and 4 is a pair of gRNAs. Four ETV6 gRNA plasmids used the same backbone(Addgene plasmid#41824). ETV6 gRNA-4 target the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc
Plasmid#226718PurposePlasmid enabling yeast-mediated expression and secretion of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
UseTagsHA tag and Mating factor alpha secretion signalExpressionYeastMutationPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_min1-2_4XEboxMutant
Plasmid#215026PurposeFirefly luciferase enhancer reporter plasmid with minimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutatedDepositorInsertMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutated
UseLuciferaseTagsExpressionMutation4X E-box mutations within Coordinator motifsPromoterSV40Available SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-503-WPRE
Plasmid#174133PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-503 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-427-WPRE
Plasmid#174135PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-427 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
R619-M96-303: CMV51p> TPAss-SARS-CoV-2 S-RBD(318-529)-3C-His8-SBP
Plasmid#166020Purposemammalian expression of SARS-CoV-2 spike receptor-binding domain (RBD) optimized for serologyDepositorAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFnCpf1GG
Plasmid#131010PurposeBackbone plasmid for generating CRISPR arrays for FnCas12a. Contains a GFP-dropout cassette and a direct repeat.DepositorInsertsdirect repeat of FnCas12a
GFP expression cassette
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK.myc-MYPT1
Plasmid#24101DepositorInsertMyosin-targeting subunit-1 (PPP1R12A Human)
UseTagsMycExpressionMammalianMutationS50G, P415QPromoterAvailable SinceMarch 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-Keratin-17
Plasmid#55379PurposeNote- This plasmid contains Keratin 18. Localization: Cytokeratin, Excitation: 433, Emission: 475DepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only