-
Plasmid#127521PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 2 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)2
Plasmid#127504PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 2 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)4
Plasmid#127505PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LacZ_pHIVEGFP
Plasmid#191251PurposeExpresses LacZ in mammalian cells (used as a control)DepositorInsertLacZ
UseTagsEGFPExpressionMammalianMutationPromoterEF1alphaAvailable sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRL_yEGFP_hc
Plasmid#98746PurposeReporter plasmid for the PhiReX system. Encodes the reporter gene yEGFP under the control of the CYC1 minimal promoter with upstream synTALE-DBS.DepositorInsertYeast-enhanced green fluorescent protein
UseSynthetic BiologyTagsExpressionYeastMutationPromotersyntheticAvailable sinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)Bxb1
Plasmid#127511PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)phiC31
Plasmid#127527PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)Bxb1
Plasmid#127528PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)phiC31
Plasmid#127510PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S(rc)2_4_5-GFP
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-PERK(LD)-EGFP
Plasmid#225680PurposeUsed to generate stable cell lines that express PERK(LD)-EGFP. This plasmid serves as a control for pLVX-PERK(LD)-EGFP-HOTag3.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS305-mAID-Nb(VHHGFP4)
Plasmid#198412PurposeExpress mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertmAID-Nb (VHHGFP4)
UseTagsExpressionYeastMutationPromoterADH1 promoterAvailable sinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pALS3-Ma-SUMO-sfGFP-WT
Plasmid#212122PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses SUMO-sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.DepositorInsertsSUMO-sfGFP-WT
M. alvus Pyl-tRNA(6)
UseTagsHis6 and SUMOExpressionBacterialMutationPromoteraraC and lppAvailable sinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Crym-eGFP
Plasmid#200080PurposeTo study u-crystallin protein interactors, control plasmidDepositorInsertGfaABC1D-Crym-eGFP
UseAAV and Mouse TargetingTagseGFPExpressionMutationPromoterGfaABC1DAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUBC_mCherry_serinemod_E488QADAR_p2A_yGFP
Plasmid#154786PurposeExpresses mCherry fused to hyperactive ADAR catalytic domain, control plasmid for HyperTRIBEDepositorInsertAdenosine deaminse (Adar Fly, Synthetic)
UseLentiviralTagsGFP, V5, and mCherryExpressionMammalianMutationSynonymized serine to prevent autoediting of ADAR…PromoterUBCAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAB_PalkB_sfgfp_KanR
Plasmid#166503PurposeExpression of sfGFP under control of PalkB promoter. Sensor output plasmid for detection of n-butanol and branched-chain higher alcohols.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPalkBAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP-mirNega
Plasmid#163705PurposepAAV plasmid to induce expression of universal negative control micro-RNA and EGFPDepositorInsertmirNega and EGFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE
Plasmid#202199PurposeExpresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the optimized PdCO under control of human synapsin1 promotor after Cre-dependent recombinationDepositorHas ServiceAAV1 and AAV5InsertstChrimsonR, PdCO
UseAAV and Cre/LoxTagsEGFP and Rho1D4ExpressionMammalianMutationPromoterhSyn1Available sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only