We narrowed to 17,771 results for: IGH@
-
Plasmid#40260PurposeRFP with robust performance in protein fusions and useful as FRET acceptor for Clover in a FRET pair that offers bright fluorescence, dynamic range, and photostability while limiting emissions overlapDepositorHas ServiceCloning Grade DNAInsertmRuby2
TagsHis6 and XpressExpressionMammalianPromoterCMV IEAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
ICAM4-CD4d3+4-bio
Plasmid#73102PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding ICAM4 with rat CD4d3+4-bioDepositorInsertICAM4 (ICAM4 Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
CD55-CD4d3+4-bio
Plasmid#73116PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding CD55 with rat CD4d3+4-bioDepositorInsertCD55 (CD55 Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
AchE-CD4d3+4-bio
Plasmid#73119PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding AchE with rat CD4d3+4-bioDepositorInsertAchE (ACHE Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERMAP-CD4d3+4-bio
Plasmid#73107PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding ERMAP with rat CD4d3+4-bioDepositorInsertERMAP (ERMAP Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lutheran-CD4d3+4-bio
Plasmid#73101PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding Lutheran with rat CD4d3+4-bioDepositorInsertLutheran (BCAM Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-4
Plasmid#72679PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Cam resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lactotransferrin-CD4d3+4-bio
Plasmid#73124PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding Lactotransferrin with rat CD4d3+4-bioDepositorInsertLactotransferrin (LTF Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKD279.8
Plasmid#173171PurposeEncodes expression of SO_4388(REC)-PsdR(DBD) 137 and an sfGFP reporterDepositorInsertsSO_4388(REC)-PsdR(DBD) 137
sfGFP
ExpressionBacterialPromoterJ23108 and PpsdA110Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-attP
Plasmid#51019PurposeVector for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Contains the visible marker 3xP3-DsRed. As known as pHD-DsRed-attPDepositorInsertsattP
LoxP-3xP3-DsRed-LoxP
UseHigh copy, amp resistancePromoter3xP3 and NoneAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Clover
Plasmid#40259PurposeGFP with robust performance in protein fusions and useful as FRET donor for mRuby2 in a FRET pair that offers bright fluorescence, dynamic range, and photostability while limiting emissions overlapDepositorHas ServiceCloning Grade DNAInsertClover GFP
ExpressionMammalianPromoterCMV IEAvailable SinceSept. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
RhopH2-bio
Plasmid#47798PurposeExpresses enzymatically monobiotinylated full-length RhopH2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
GAMA-bio
Plasmid#47747PurposeExpresses enzymatically monobiotinylated full-length GAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised GAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
F5-bio-His
Plasmid#53426PurposeExpresses full-length Coagulation factor V precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertF5 (F5 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pf113-bio
Plasmid#47729PurposeExpresses enzymatically monobiotinylated full-length Pf113 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised Pf113
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
P41-bio
Plasmid#47739PurposeExpresses enzymatically monobiotinylated full-length P41 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P41
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PET-B-HypaSpCas9-NLS-6xHis
Plasmid#207386PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertB-HypaSpCas9
UseCRISPRTags6xHisExpressionBacterialMutationN692A, M694A, Q695A, H698A, amino acids 1005-1013…PromoterT7Available SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-3
Plasmid#72678PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Kan resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only