We narrowed to 4,082 results for: Gaa
-
Plasmid#91618PurposeExpress sgRNA targeting human FXR1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
sgRNA1_pNeurog2-Luciferase reporter
Plasmid#64160PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target pNeurog2-Luciferase reporter.DepositorInsertsgRNA1 for pNeurog2-Luciferase reporter
UseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX458- PSMF1 guide 1
Plasmid#251203PurposeTransient transfection-compatible vector driving expression of spCas9 and production of sgRNA targeting exon2 of PSMF1DepositorInsertPSMF1 guide 1
UseCRISPRExpressionMammalianAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-Puro
Plasmid#215362PurposeExpresses a rat Letm1 specific shRNADepositorInsertLetm1 shRNA Target sequence (Letm1 Rat)
UseLentiviralAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-1-shH2B
Plasmid#240417PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianPromoterTREAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGCas9_scr
Plasmid#207567PurposeGeoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_GeoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-31 (nonfunctional)
Plasmid#246314PurposeEvaluation of PtU6.2c4 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2c4 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationdeletions: -A (-41 from TSS), -T (-30), -T (-29);…PromoterPtU6.2c4 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circPKHD1_1
Plasmid#215230PurposeSupression of shcircPKHD1(28,29,34,35)_1 expressionDepositorInsertcircPKHD1 shRNA 1 (PKHD1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm4
Plasmid#222909PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 4 (FIGLA Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm3
Plasmid#222908PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 3 (FIGLA Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
plentiCRISPR-v2 Puro CHKA_sg2
Plasmid#218523PurposesgRNA targeting human CHKADepositorInsertCHKA (CHKA Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiBIRC6-1
Plasmid#202447PurposeExpression of a CRISPRi guide targeting BIRC6DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB2
Plasmid#197355PurposeA knock-out vector for dog ErbB2.DepositorInsertA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgBIRC6-4
Plasmid#202438PurposeExpression of a guide RNA targeting BIRC6DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only