We narrowed to 14,179 results for: CRISPR-Cas9
-
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgGFP1-7SK-sgCas9
Plasmid#87908Purposemultiple sgRNADepositorInsertsgGFP1, sgCas9
UseGateway CloningPromoterH1, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-L101_guide-CBh-hSpCas9
Plasmid#188547PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-(BB)-2A-Puro-HsHelz-sgRNA_AH
Plasmid#148897PurposeMammalian Expression of HsHelz-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2815 pPB: CAG-Puro-WPRE PGK-KRAB-tagBFP-SpdCas9
Plasmid#84245PurposeExpresses direct fusion KRAB-Sp dCas9DepositorInsertsKRAB-tagBFP-Sp dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), HA tag, KRAB, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant
Plasmid#101208PurposeBacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A and Q695APromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP
Plasmid#154139PurposeExpresses the dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP fusion protein for targeted DNA methylation.DepositorInsertdCas9, DNMT3a (catalytic domain), DNMT3l (C-terminal part), tagBFP
Tags3x FLAG and tagBFPExpressionMammalianPromoterCMVAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg2dCas9-KRAB-T2a-GFP
Plasmid#234881PurposeL1HS-silencing plasmid (CRISPRi gRNA2)DepositorInsertLacZ gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SlugCas9-NNG-P2A-puro
Plasmid#214352PurposeExpresses SlugCas9-NNG and puromycin resistance genesDepositorInsertSlugCas9-NNG and puromycin resistance genes
ExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-enCas9(D10A)-PolI5MΔ
Plasmid#249068PurposeExpresses nucleus-localized enCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertenCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFGC-I2Cas9
Plasmid#173158PurposeExpresses Cas9 in dividing Arabidopsis cells. Contains dsRED and Basta for fast transformant selection.DepositorInsertshSpCas9
pNAP:dsRED:tNOS
pMAS:BAR:tMAS
ICU2 upstream regulatory region
Tags3xFLAG-NLS and NLSExpressionPlantMutationContains a D169N mutation with no visible effect …Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTMN140 - UCOE-SFFV-VPH-XTEN-dCas9-IRES2-BFP-T2A-Blast
Plasmid#238166PurposeExpress VPH-dCas9 and BFP-T2A-BlasticidinR in mammalian cells. LentiviralDepositorInsertVPH-dCas9
UseCRISPR and LentiviralTagsmTagBFP2Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only