We narrowed to 15,154 results for: GRN
-
Plasmid#243747PurposePVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNADepositorInsertvegfa sgRNA-pvc18-20
ExpressionBacterialAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV 3xgRNA KO;Template
Plasmid#240310PurposeKO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA1-Filler-v2
Plasmid#237400PurposeFor inserting a single guide RNA or later cloning two U6-gRNA cassettes with MIGR1-U6gRNA1-Filler-v1.DepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterU6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-EWSR1-gRNA
Plasmid#237683PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to EWSR1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-FUS-gRNA
Plasmid#237685PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 atgRNA pDY2250
Plasmid#219860Purposeattachment site pegRNA for human NOLC1DepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pABE-dGFP-gRNA
Plasmid#226864PurposeHuman gRNA expression vector targeting the A111V mutation of non-fluorescent EGFP in plasmid pABE-dGFP; for use with ABEsDepositorInsertSp-gRNA
ExpressionMammalianPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-TCAB1 KI sgRNA
Plasmid#207611PurposesgRNA for HaloTag insertion into the endogenous TCAB1 locusDepositorInsertCCAAAGTCTTCATACTGCAG
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterEF1a and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xControlgRNA
Plasmid#224567PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xPax7gRNA
Plasmid#224569PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND2 targeting gRNA
Plasmid#215318PurposeExpresses gRNA targeting CCND2 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND1 targeting gRNA
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC1 gRNA1
Plasmid#211630PurposesgRNA-1 against ERCC1DepositorInsertsgRNA ERCC1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only