We narrowed to 3,492 results for: aaas
-
Plasmid#75617Purpose3rd generation lentiviral gRNA plasmid targeting human TLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TBCK gRNA (BRDN0001149038)
Plasmid#75566Purpose3rd generation lentiviral gRNA plasmid targeting human TBCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001145731)
Plasmid#75533Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001147018)
Plasmid#75535Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001147921)
Plasmid#75536Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MVK gRNA (BRDN0001145420)
Plasmid#77407Purpose3rd generation lentiviral gRNA plasmid targeting human MVKDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB3 gRNA (BRDN0001146652)
Plasmid#77200Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB3DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
NRBP2 gRNA (BRDN0001147825)
Plasmid#76453Purpose3rd generation lentiviral gRNA plasmid targeting human NRBP2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hMIB2_#9
Plasmid#75255Purposeretroviral shRNA vector against human MIB2, expresses GFP for transduction controlDepositorInsertshRNA against MIB2 (human) (MIB2 Human)
UseRNAi and RetroviralExpressionMammalianPromotermU6Available SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #2
Plasmid#136583PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1
Plasmid#187458PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 epegRNA (tevopreQ1) with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAP1-2
Plasmid#125838PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
shYAP1 # 1
Plasmid#42540DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
shYAP1 # 2
Plasmid#42541DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only