We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerExpressionBacterialAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-entry-puro
Plasmid#85745PurposeLentiviral vector for generating multiple sgRNAs carrying plasmids by Golden Gate Assembly.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEY1.1.0-gDNA
Plasmid#112393PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HEY1DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDDIT3.1.0-gDNA
Plasmid#112396PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor DDIT3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHSE401
Plasmid#62201PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKSE401
Plasmid#62202PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
gh19
Plasmid#106703Purposeexpression of gRNA targeting GALNT19DepositorInsertGALNT19
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-