We narrowed to 8,402 results for: 221
-
Plasmid#39751DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pCRII-Topo Chn2 in situ probe
Plasmid#45625DepositorInsertChn2 in situ probe (Chn2 Mouse)
UseIn situMutationfragment contains bp# 2212-2619 of BC051139.1Available SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
KHBD00629
Plasmid#39699DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
-
KHBD00751
Plasmid#39757DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET Assay Vector, NanoLuc-KRAS(G12V)
Plasmid#236859PurposeExpress NanoLuc(R)-KRAS(G12V) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertKRAS (KRAS Human)
TagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12VPromoterCMVAvailable SinceSept. 22, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET Assay Vector, NanoLuc-KRAS WT
Plasmid#236878PurposeExpress NanoLuc(R)-KRAS WT in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertKRAS (KRAS Human)
TagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28b C7H1G6_6H N-terminal
Plasmid#223434PurposeC7H1G6 GNAT expression vector with N-terminal His6 tagDepositorInsertC7H1G6 GNAT
TagsHis6Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28b R6CZ24_6H C-terminal
Plasmid#223435PurposeR6CZ24 Thiolase expression vector with C-terminal His6 tagDepositorInsertR6CZ24 Thiolase
TagsHis6Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-NOT1 isoform C-mCherry-PH (EB5)
Plasmid#206474PurposeNOT1 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mGCC2-FLAG
Plasmid#214166PurposeTransient expression of GCC2DepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mXRCC1pd-eGFP
Plasmid#206035PurposeMammalian expression of PAR-deficient mXRCC1pd coupled to eGFP under the control of a EF1a promoterDepositorInsertmXRCC1pd
TagseGFPExpressionMammalianMutationS105A, S186A, K188A, S195A, S221A, S222A,S238A, S…PromoterEf1aAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-cat_dom_HDAC5)
Plasmid#114401PurposeFor PYL-HDAC5 catalytic domain expressionDepositorInsertPYL-HDAC5 catalytic domain
Tags3xFlag-NLS (internal)ExpressionMammalianMutationS220F and the deletion of M221PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-DmNot1_1468-1719_AF
Plasmid#148740PurposeBacterial Expression of DmNot1_1468-1719DepositorInsertDmNot1_1468-1719 (Not1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot1_1467-1717_AE
Plasmid#148598PurposeInsect Expression of DmNot1_1467-1717DepositorInsertDmNot1_1467-1717 (Not1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot1_J
Plasmid#146710PurposeInsect Expression of DmNot1DepositorInsertDmNot1 (Not1 Fly)
ExpressionInsectMutation11 silent mutations compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-4mut-siRNAres_E
Plasmid#146193PurposeInsect Expression of DmEDC3-4mut-siRNAresDepositorInsertDmEDC3-4mut-siRNAres (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-5mut-siRNAres_E
Plasmid#146194PurposeInsect Expression of DmEDC3-5mut-siRNA resDepositorInsertDmEDC3-5mut-siRNA res (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-ADF_E
Plasmid#146195PurposeInsect Expression of DmEDC3-ADFDepositorInsertDmEDC3-ADF (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-FAF_E
Plasmid#146199PurposeInsect Expression of DmEDC3-FAFDepositorInsertDmEDC3-FAF (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-FDA_E
Plasmid#146200PurposeInsect Expression of DmEDC3-FDADepositorInsertDmEDC3-FDA (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-etsrp
Plasmid#164655Purposefor the synthesis of zebrafish etsrp mRNADepositorInsertetsrp (etsrp Zebrafish)
UseMrna synthesisAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3_1-101-V5His6_D
Plasmid#146121PurposeInsect Expression of DmEDC3_1-101DepositorInsertDmEDC3_1-101 (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3_1-338-V5His6_D
Plasmid#146122PurposeInsect Expression of DmEDC3_1-338DepositorInsertDmEDC3_1-338 (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmEDC3_441-680_D
Plasmid#146127PurposeInsect Expression of DmEDC3_441-680DepositorInsertDmEDC3_441-680 (Edc3 Fly)
ExpressionInsectMutation3 mutations N162T, K221E and D418G compared to th…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3_441-680_D
Plasmid#146130PurposeInsect Expression of DmEDC3_441-680DepositorInsertDmEDC3_441-680 (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-D61A_D
Plasmid#146131PurposeInsect Expression of DmEDC3-D61ADepositorInsertDmEDC3-D61A (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-D61K_D
Plasmid#146132PurposeInsect Expression of DmEDC3-D61KDepositorInsertDmEDC3-D61K (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-N44A_D
Plasmid#146135PurposeInsect Expression of DmEDC3-N44ADepositorInsertDmEDC3-N44A (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-mRnf185
Plasmid#175126PurposeLentiviral expression of V5-tagged mouse Rnf185DepositorAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Tmem43-V5
Plasmid#175111PurposeLentiviral expression of mouse Tmem43-V5DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR(EF)-tRNA(Q)
Plasmid#170517PurposePCR template vector for amplifying gRNAcore(EF)-tRNA(Q) fragment; used together with pAC-U63-tgRNA-nlsBFP or pAC-U63-tgRNA-Gal80DepositorInsertgRNAcore(EF)-tRNA(Q)
UsePcr template vector for amplifying grnacore(ef)-t…Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-KRAB-dCas9
Plasmid#120356PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS-KRAB-dCas9
Plasmid#120357PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOK+9MS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [1-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2308 - [1-2] ENTR - Fluor - mNeon(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
Plasmid#159852PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mNeon(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1827
Plasmid#154323PurposeMulti-cassette for SapTrapDepositorInsert30aa linker::mScarlet-I
UseCRISPRExpressionWormAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1841
Plasmid#154338PurposePromoter reporterDepositorInsertSV40 NLS::mScarlet_I(dpi)::-tbb-2 3'UTR
ExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IP803: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-Dnmt3a3L
Plasmid#121826PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO602: pMVP (L3-L2) HA tag + pA; CMV::TETa-pA
Plasmid#121802PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven TETaDepositorInsertHA epitope tag-polyA + CMV::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA601: pMVP (L3-L2) pA; EF1a::TETa-pA
Plasmid#121805PurposepMVP L3-L2 entry plasmid, contains polyA + EF1a-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds EF1a-driven TETa downstream of gene of interest.DepositorInsertpolyA + EF1a::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA401: pMVP (L3-L2) pA; RIP::TETa-pA
Plasmid#121809PurposepMVP L3-L2 entry plasmid, contains polyA + RIP-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds RIP-driven TETa downstream of gene of interest.DepositorInsertpolyA + RIP::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO502: pMVP (L3-L2) HA tag + pA; RIP::TETa-pA
Plasmid#121810PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven TETaDepositorInsertHA epitope tag-polyA + RIP::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IA304: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-VPR
Plasmid#121822PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IB801: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-KRAB
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ101: pMVP (L3-L2) P2A-eCFP + polyA
Plasmid#121768PurposepMVP L3-L2 entry plasmid, contains eCFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eCFP linked by P2A to gene of interest.DepositorInsertP2A-eCFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only