We narrowed to 43,236 results for: cha
-
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSFDUET-1_VNp-anti-Lysozyme fAb-BiFC
Plasmid#214950PurposeBacterial expression of anti-chicken lysozyme Fab light and heavy chain VNp fusions. Each chain is fused to separate halves of a BiFC protein -Venus fluorescence signifies Hc/Lc heterodimer formation.DepositorInsertsVNp-anti-Lysozyme Fab heavy chain amino-BiFC fusion
VNp-anti-Lysozyme Fab light chain amino-BiFC fusion
UseTags6xHis, Amino half of venus BIFC fragment, Carboxy…ExpressionBacterialMutationPromoterT7Available sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro XLone-CCND2
Plasmid#179845Purposedonor plasmid for inducible expression of CCND2 in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR, Luciferase, and TALEN ; Donor plasmidTagsExpressionMammalianMutationPromoterTRE3GSAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-3
Plasmid#218798PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-3
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-4
Plasmid#218799PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-4
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AtSLAC1 WT
Plasmid#212946PurposeVector used for expression of AtSLAC1 WT in mammalian cellDepositorInsertSlow anion channel-associated 1 (OZS1 Mustard Weed)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AtSLAC1 6D
Plasmid#212947PurposeVector used for expression of AtSLAC1 6D in mammalian cellDepositorInsertSlow anion channel-associated 1 (OZS1 Mustard Weed)
UseTagsExpressionMammalianMutationT62D/S65D/S107D/S124D/S146D/S152DPromoterCMVAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-HAPPID1
Plasmid#204626PurposeExpresses the human anti-Phl p 7 IgD/λ antibody 102.1F10 (HAPPID1) in mammalian cells. HAPPID1 binds to the grass pollen allergen Phl p 7 with subnanomolar affinity.DepositorInsertsHAPPID1 heavy chain
HAPPID1 light chain
UseTagsExpressionMammalianMutationPromotermouse elongation factor 1 alpha and rat elongatio…Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
An HA CAAX pMT2
Plasmid#206116Purposeexpression of Cav2.1 N-terminus (amino acids 1-100) with a C-terminal CAAX (last 10aa of H.Ras) motif and a HA tagDepositorInsertcacna1a (Cacna1a Rat)
UseTagsExpressionMammalianMutationPromoterAd MLP/TPL/SV40Available sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
An CAAX pMT2
Plasmid#206118Purposeexpression of Cav2.1 N-terminus (amino acids 1-100) with C-terminal CAAX (last 10 aa of H.Ras) motifDepositorInsertcacna1a (Cacna1a Rat)
UseTagsExpressionMammalianMutationPromoterAd MLP/TPL/SV40Available sinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
hTln1-R1R2-17b
Plasmid#191427PurposeExpresses a variant of the human TLN1 R1R2 domains containing a 17AA insert into R2 (exon 17b) in bacteriaDepositorInsertHuman Talin1 R1R2 domains (TLN1 Human)
UseTagsHis-tag, TEV cleavage siteExpressionBacterialMutationcontains 17AA insertion from inclusion of exon 17bPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorUseTagsExpressionYeastMutationPromoterSNR52Available sinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorUseTagsExpressionYeastMutationPromoterSNR52Available sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
UseTagsAID(71-114) and mCherryExpressionYeastMutationPromoterNative promoterAvailable sinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c022
Plasmid#175490PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be biotinylated.DepositorInsertSYK (SYK Human)
UseTagsAviTag and His6-TEVExpressionBacterialMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-Cas9-BirA*
Plasmid#159993PurposeBacterial expression of Cas9-BirA*DepositorInsertCas9-BirA*
UseTags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 S3070F
Plasmid#139325PurposePlasmid expressing a sgRNA to introduce BRCA2 S3070F using base editingDepositorInsertsgRNA to insert BRCA2 S3070F using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 S1363L
Plasmid#139329PurposePlasmid expressing a sgRNA to introduce BRCA1 S1363L using base editingDepositorInsertsgRNA to insert BRCA1 S1363L using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E1754K
Plasmid#139330PurposePlasmid expressing a sgRNA to introduce BRCA1 E1754K using base editingDepositorInsertsgRNA to insert BRCA1 E1754K using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA FANCD2 Q223Stop
Plasmid#139332PurposePlasmid expressing a sgRNA to introduce FANCD2 Q223Stop using base editingDepositorInsertsgRNA to insert FANCD2 Q223Stop using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 NPm
Plasmid#126593PurposeExpresses siRNA resistant SENP2 (nuclear pore mutant) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationDeletion of amino acids 1-65 and L329A/L331A in t…PromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 CCm
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-Puro
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGExpressionMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-Puro
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGExpressionMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGExpressionMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGExpressionMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S285C
Plasmid#98665PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285CDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationS285CPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S329C
Plasmid#98667PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S329CDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationS329CPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V
Plasmid#98658PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationD290VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D220V
Plasmid#98659PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D220VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationD220VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D230V
Plasmid#98660PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D230VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationD230VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L
Plasmid#104465Purposeexpress His tagged P298L hnRNPA2 LCDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHisExpressionBacterialMutationP298LPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R254K
Plasmid#104466Purposeexpress MBP hnRNPA2 LC with 2 R to K mutationsDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHis-MBPExpressionBacterialMutationR191K R254KPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L_S329C
Plasmid#104470Purposeexpress His tagged P298L S329C hnRNPA2 LCDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHisExpressionBacterialMutationP298L S329CPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only