We narrowed to 3,474 results for: biorxiv
-
Plasmid#218095PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn-PinkyCaMP
Plasmid#232856PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under hSyn promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-gfaABC1D-PinkyCaMP
Plasmid#232859PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under gfaABC1D promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromotergfaABC1DAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN1-PinkyCaMP
Plasmid#232861PurposeA vector expressing the mScarlet based calcium indicator PinkyCaMP under CMV promoterDepositorInsertPinkyCaMP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C EGFR EABR
Plasmid#234994PurposeFor production of Extracellular Vesicles (EVs), with Epithelial Growth Factor Receptor on their surface, Strep-tag II labeled on its N-terminusDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
ubbr:GCaMP8m
Plasmid#232485PurposeTo make fish transgenic lines that have calcium sensor expression in the whole body of the fishDepositorInsertjGCaMP8m
UseZebrafish expressionPromoterubbrAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
YY171: pPB_NFκB::GFP-GEMINI(A)_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228883PurposePiggyBac plasmid expressing the GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
ExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_NANOS3_cterm
Plasmid#222904PurposeCas9/sgRNA plasmid for targeting NANOS3DepositorInsertCas9, NANOS3 sgRNA (NANOS3 Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-PinkyCaMP
Plasmid#232858PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CaMKII promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1314-AAV-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223159PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-LDLR-mCherry BlastR
Plasmid#186739PurposeDox inducible LDLR coding sequence expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianPromoterTRE3GAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DLX5
Plasmid#222927PurposePiggyBac transposon plasmid for doxycycline inducible expression of DLX5DepositorInsertDLX5 (DLX5 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HA
Plasmid#242768PurposeAAV transfer plasmid expressing eGFP-HA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHAPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only