We narrowed to 6,409 results for: Gaa
-
Plasmid#242706PurposeshRNA knockdown human DLD geneDepositorInsertDLD (DLD Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZNF302.1.0-gDNA
Plasmid#132467PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF302 (ZNF302 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSM004
Plasmid#122937PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYML065W (Marked)
ExpressionYeastMutationYML065W: bp 52-63 GAGCAGGGAAAT to GAACAAGGTAACPromoter[tetO2]4inPgal1Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pWT029h
Plasmid#96861Purpose(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)DepositorInsert(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(43))-PGKpuro2ABFP-W
Plasmid#200464PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(43) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001144984)
Plasmid#77721Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RET gRNA (BRDN0001147871)
Plasmid#77496Purpose3rd generation lentiviral gRNA plasmid targeting human RETDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only