We narrowed to 3,474 results for: biorxiv
-
Plasmid#225697PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEF1aAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GNT5-blast
Plasmid#208380Purposelentiviral vector for expressing human B3GNT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertBeta-1,3-N-Acetylglucosaminyltransferase 5 (B3GNT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnt 922 c->g (PAM site inactivation)PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5-blast
Plasmid#208381Purposelentiviral vector for expressing human B3GALT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnucleotide change in PAM targeting sequence nt 51…PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg1 hp
Plasmid#218093PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-CITED4(130-184) + CBP TAZ1(340-439)
Plasmid#254288PurposeBacterial coexpression of human CITED4 CTAD with CBP TAZ1DepositorTags6X His-tagged GB1ExpressionBacterialPromoterT7Available SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-CITED1(146-193) + CBP TAZ1(340-439)
Plasmid#254286PurposeBacterial coexpression of human CITED1 CTAD with CBP TAZ1DepositorTags6X His-tagged GB1ExpressionBacterialPromoterT7Available SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HSV
Plasmid#242769PurposeAAV transfer plasmid expressing eGFP-HSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHSVPromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-T7
Plasmid#242778PurposeAAV transfer plasmid expressing eGFP-T7 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsT7PromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSico-syn-GFP-TVA-oG-WPRE-bGHpA
Plasmid#231009PurposeLentiviral helper virus for G-deleted rabies tracingDepositorAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-opEas1
Plasmid#240701PurposeRSF1010 origin of replication plasmid containing Eas1 recombitron with extended a1 a2 regions in the ncRNA targeting lacZ locus in Klebsiella pneumoniae ATCC 10031 expressed by Pm promoterDepositorInsertEas1 RT, Eas1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only