We narrowed to 3,862 results for: biorxiv
-
Plasmid#248105PurposeExpresses dox-inducible OptoCas13d or CasRx-QK634-LightR (LightR domain inserted right after amino acid residue 634 of CasRx)DepositorInsertCasRx-LightR
UseCRISPR and Synthetic BiologyPromoterTet inducibleAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mCherry-LATeNT
Plasmid#240989PurposeExpresses mCherry-LATeNT in mammalian cells; for AAV transduction of neuronsDepositorInsertmCherry-V5-LATeNT
UseAAVTagsV5 (internal)ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CCR6-NanoLuc
Plasmid#240982PurposeExpresses CCR6-NanoLuc in mammalian cells; used with LATeNT*-ArrestinDepositorInsertCCR6-NanoLuc-V5
TagsV5ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAct1-LexA-VP16-VAMP2 + LexO-YFP
Plasmid#240975PurposeExpresses membrane-anchored transcription factor (LexA-VP16) in yeast, along with YFP reporter under LexO promoterDepositorInsertLexA-VP16-VAMP2, LexO::YFP
ExpressionYeastAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
R26_CAG_BST_FUCCIplex
Plasmid#240241PurposeROSA26 knock-in vector with homology-mediated end joining(HMEJ)-based method. The CAG promoter drives the expression of the FUCCIplex sensor.DepositorInsertFUCCIplex
ExpressionMammalianPromoterCAGAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-M
Plasmid#242203PurposeOsU6-2p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in monocots.DepositorInsertLevel1 OsU6-2p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterOsU6-2pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-M
Plasmid#242204PurposeOsU6-2p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in monocots.DepositorInsertLevel1 OsU6-2p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterOsU6-2pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-D
Plasmid#242205PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-D
Plasmid#242206PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe EF-C
Plasmid#244968PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (EF hands 1/2- Cterminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-103…PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-SHP2(R138Q)
Plasmid#245228PurposeMammalian expression of myc-tagged full-length SHP2DepositorInsertSHP2 full-length
TagsmycExpressionMammalianMutationR138QAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-SHP2(Q510K)
Plasmid#245235PurposeMammalian expression of myc-tagged full-length SHP2DepositorInsertSHP2 full-length
TagsmycExpressionMammalianMutationQ510KAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-SHP2(R4A,R5A)
Plasmid#245221PurposeMammalian expression of myc-tagged full-length SHP2DepositorInsertSHP2 full-length
TagsmycExpressionMammalianMutationR4A,R5AAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-SHP2(T468M)
Plasmid#245231PurposeMammalian expression of myc-tagged full-length SHP2DepositorInsertSHP2 full-length
TagsmycExpressionMammalianMutationT468MAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-TurboID
Plasmid#245241PurposeProximity-labeling proteomics negative controlDepositorInsertTurboID
ExpressionMammalianMutationwild-typeAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-DS55
Plasmid#187175PurposeThis modified pET22b-DS55 vector contains Sal I and Hind III sites in reverse orientations to directly clone scFv phagemid from HuScL-4 library for bacterial expression systems.DepositorTypeEmpty backboneTagsHis tagExpressionBacterialPromoterAmpR, lac1Available SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only