We narrowed to 8,512 results for: sgrna
-
Plasmid#119629PurposeLevel 0 Part. CDSDepositorInsertsgRNA scaffold
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT01
Plasmid#223373PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT02
Plasmid#223374PurposeT-DNA vector for SpCas9 mediated mutagenesis for plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Frodo-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210734PurposeCoding for SaSp D10A Cas9 alongside Frodo sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Frodo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMR-A-3-Sasg
Plasmid#214349PurposeExpresses T7-RNAP, and cloning backbone for sgRNADepositorInsertT7-RNAP
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
p8391 LentiCRISPRv2 Neo sgPTPN14-1
Plasmid#221651PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-1 (PTPN14 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8392 LentiCRISPRv2 Neo sgPTPN14-3
Plasmid#221652PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-3 (PTPN14 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRhaCAST
Plasmid#211791PurposepZLrhaB2plus with Sh-cas12K-tnsBC-tniQ cloned into, which drives by the rhamnose inducible promoterDepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning
UseCRISPRTagsExpressionBacterialMutationPromoterRhamnose-inducibleAvailable sinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastMutationPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Merry-eCMV-SaSpD10A+linker (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210736PurposeCoding for SaSp D10A Cas9 alongside Merry sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Merry sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Gollum-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210735PurposeCoding for SaSp D10A Cas9 alongside Gollum sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Gollum sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-sgHPRT1
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterEF1a/hU6Available sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
NarCas9_AAV
Plasmid#192145PurposeExpresses NarCas9?and cloning backbone for sgRNADepositorInsertNarCas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterBBa_J23119Available sinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-doraWT_rescue_construct
Plasmid#190608PurposePuromycin-selectable expression of HA-tagged Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
UseTags3xHAExpressionInsectMutationPromoterActin-5cAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralTagsExpressionMutationPromotermU6 and UbCAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #3
Plasmid#174165Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #9
Plasmid#174166Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX300A-G+Nanog
Plasmid#140280PurposeCRISPR/Cas9 plasmid encoding Cas9 and sgRNA against gBait and Nanog locusDepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterCBHAvailable sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA2963_eSpCas9-PGKHygdtkCh
Plasmid#124205PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF704
Plasmid#121658PurposeU6-sgRNA EFS-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF712
Plasmid#121663PurposeU6-sgRNA EF1a-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-compact
Plasmid#99369PurposeExpresses Cas9-Nlux and sgRNA. Contains CEN/ARS. No selection marker.DepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-NluxExpressionMutationPromoterRibi promoterAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0075
Plasmid#117642PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SaCas9(pEPOR1CB0015) and sgRNA_Flavin-binding monooxygenase family protein {AT1G62600}(pEPOR1CB0098)and sgRNA_Flavin-binding monooxygenase family protein {AT1G62590}(pEPOR1CB0109)DepositorInsert[35S:SaCas9(pEPOR1CB0015) ] +[AtU6-26:sgRNA]
UseTagsExpressionPlantMutationPromoterAvailable sinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralTagsExpressionMutationPromoterAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pCas59
Plasmid#82396PurposesgRNA targeting YFP +787 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
UseTagsExpressionMutationPromoterPEZ3Available sinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas45
Plasmid#82390PurposesgRNA targeting YFP with additional bases 5' end like pCas34, but from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
UseTagsExpressionMutationPromoterPJ23119Available sinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas57
Plasmid#82395PurposesgRNA targeting YFP +111 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
UseTagsExpressionMutationPromoterPEZ3Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only