We narrowed to 7,835 results for: lenti crispr
-
Plasmid#170295PurposeA knock-out vector for the mouse Nectin-2DepositorInsertA gRNA targeting the mouse Nectin-2 gene.
UseCRISPR and LentiviralAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Necl-5
Plasmid#170294PurposeA knock-out vector for the mouse Necl-5DepositorInsertA gRNA targeting the mouse Necl-5 gene.
UseCRISPR and LentiviralAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgACO1_3
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSmg7
Plasmid#161809Purposeguide RNA for Smg7DepositorInsertsgRNA targeting mouse Smg7 (Smg7 Synthetic, Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-CENPB
Plasmid#120208PurposegRNA targeting the stem loop of CENPB poly(A) siteDepositorInsertCENPB poly(A) site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgAMDHD1
Plasmid#102316Purposegenetic depletion of AMDHD1DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR sgNFS1
Plasmid#102979PurposeCutting NFS1 genomic locusDepositorInsertsgNFS1 (NFS1 Human)
UseCRISPR and LentiviralAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-2
Plasmid#86135PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorInsertsgRNA targeting C17orf89 (NDUFAF8 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-3
Plasmid#86136PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-1
Plasmid#86137PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-Stuffer-HepmTurquoise2
Plasmid#192826PurposeContains stuffer sequence into which sgRNAs can be cloned and expresses mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterHepatocyte-specific promoter (HS-CRM8-TTRmin modu…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2FE-ABE8e-SpRY
Plasmid#213008PurposeA lentiviral vector expressing the ABE8e-SpRY base editor and an sgRNA cloning siteDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CRISPR-v2-gYap-1
Plasmid#166481PurposeExpresses spCas9 and a gRNA targeting mouse YapDepositorInsertgRNA for mouse Yap (Yap1 Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR4GN (Lenti)
Plasmid#222693PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsGFPExpressionMammalianMutationPGK without BsmBI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-CRISPR
Plasmid#85402PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expressionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone2
Plasmid#162126PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only