We narrowed to 534 results for: src
-
Plasmid#14693DepositorAvailable SinceJune 19, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3 βarr1 S412D Flag
Plasmid#42196DepositorAvailable SinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 βarr1 S412A Flag
Plasmid#42195DepositorAvailable SinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 GST-SHP2 H116A
Plasmid#244492PurposeBacterial Expression of SHP2 mutantDepositorInsertPTPN11 (PTPN11 Human)
TagsGSTExpressionBacterialMutationchanged Histidine 116 to AlanineAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 SHP2 E252A
Plasmid#244491PurposeBacterial Expression of SHP2 mutantDepositorInsertPTPN11 (PTPN11 Human)
TagsGSTExpressionBacterialMutationchanged Glutamate 252 to AlanineAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_S94A-PolyA
Plasmid#112286PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) S94A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Serine 94 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR
Plasmid#28235PurposeMammalian expression of Androgen receptor fused to EGFPDepositorAvailable SinceApril 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
Human Wild-type ASAP1
Plasmid#235212PurposeExpresses Wild-Type ASAP1 in mammalian cellsDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR V7
Plasmid#86856PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)DepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationAlternative splice variant 7 (alteration/deletion…PromoterCMVAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y357F-PolyA
Plasmid#112287PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y357F mutant _ corresponding to tyrosine 407 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationTyrosine 357 to Phenyalanine corresponding to tyr…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 GST-SHP2 H116A E252A
Plasmid#244493PurposeBacterial Expression of pH insensitive SHP2 mutantDepositorInsertPTPN11 (PTPN11 Human)
TagsGSTExpressionBacterialMutationchanged Histidine 116 to Alanine and Glutamate 25…Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_R89A-PolyA
Plasmid#112291PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) R89A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Arginine 89 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only