We narrowed to 19,699 results for: ACE
-
Plasmid#83391Purposebacterial expression vector pVP16 containing a derivative of E. coli lacZ fused with E. coli flavin binding protein MioC to be used in N-end rule in vitro ubiquitination studiesDepositorInsertflavin binding protein MioC
UseSynthetic BiologyTags3xHA, 8xHis, and MBPExpressionBacterialMutationPromoterAvailable sinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a N
Plasmid#89383PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
UseTagsExpressionMutationPromoterAvailable sinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVH003
Plasmid#80397PurposeContains pBAD-CusR (response regulator) and pCusR-antiscaffold-YFP-AAV. This plasmid was used for microscopy tracking experimentsDepositorUseSynthetic BiologyTagsFused by GS linker to LZx domain and Venus has N-…ExpressionBacterialMutationPromoterAvailable sinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET22-HT/purC
Plasmid#73623PurposeProduces Escherichia coli 5-aminoimidazole-4-N-succinocarboxamide ribonucleotide synthetase (PurC), N-terminal His6 tagDepositorInsertphosphoribosylaminoimidazolesuccinocarboxamide synthase (purC Escherichia coli str. K-12 substr. MG1655)
UseTagsHis6ExpressionBacterialMutationContains multiple silent mutations (E179, G185, G…PromoterT7Available sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCD12_BC
Plasmid#66023PurposeMoClo Basic Part: RBS - BiCistronic Design, medium strength (RBS part type, actually contains a small transcriptional unit and second RBS) [B:BCD12:C]DepositorInsertRBS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCD2_BC
Plasmid#66024PurposeMoClo Basic Part: RBS - BiCistronic Design, high strength (RBS part type, actually contains a small transcriptional unit and second RBS) [B:BCD2:C]DepositorInsertRBS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCD8_BC
Plasmid#66025PurposeMoClo Basic Part: RBS - BiCistronic Design, low strength (RBS part type, actually contains a small transcriptional unit and second RBS) [B:BCD8:C]DepositorInsertRBS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
C0012m (lacI)_CD
Plasmid#66026PurposeMoClo Basic Part: CDS - Controller protein, lacI repressor (in concert with CAP, represses pLacI, R0010). Modified to fix illegal site. [C:C0012m:D]DepositorInsertTranscription factor
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
C0040 (tetR)_CD
Plasmid#66027PurposeMoClo Basic Part: CDS - Controller protein, tetR repressor (represses pTet, C0040. can be inhibited by tetracyclin or aTc) [C:C0040:D]DepositorInsertTranscription factor
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
C0062 (luxR)_CD
Plasmid#66028PurposeMoClo Basic Part: CDS - Controller protein, luxR repressor/activator (in concert with HSL, represses pLuxR(pR) R0063. Also up-regulates pLuxR(pL) R0062) [C:C0062:D]DepositorInsertTranscription factor
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0010 (pLacI)_EB
Plasmid#66005PurposeMoClo Basic Part: Controllable promoter - pLacI - lacI regulated (repressed by LacI+CAP. LacI, C0012, inhibited by IPTG) [E:R0010:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0010 (pLacI)_FB
Plasmid#66006PurposeMoClo Basic Part: Controllable promoter - pLacI - lacI regulated (repressed by LacI+CAP. LacI, C0012, inhibited by IPTG) [F:R0010:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0010 (pLacI)_GB
Plasmid#66007PurposeMoClo Basic Part: Controllable promoter - pLacI - lacI regulated (repressed by LacI+CAP. LacI, C0012, inhibited by IPTG) [G:R0010:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_AB
Plasmid#66008PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [A:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_EB
Plasmid#66009PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [E:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_FB
Plasmid#66010PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [F:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_GB
Plasmid#66011PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [G:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-L,LacI-L]
Plasmid#60759PurposeContains PIq driving expression GalS-L, and PI driving expression of LacI-L.DepositorInsertsGalS-L
wt LacI
UseSynthetic BiologyTagsExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with GalS L…PromoterAvailable sinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pzs1[GalS-L]
Plasmid#60743PurposeContains PIq driving expression of GalS-R, the Fucose inducible chimera with the wt Lac DBD.DepositorInsertGalS-L
UseSynthetic BiologyTagsExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with GalS L…PromoterAvailable sinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T]
Plasmid#60751PurposeContains PIq driving expression RbsR-T, the Ribose inducible chimera with the TAN DBD.DepositorInsertRbsR-T
UseSynthetic BiologyTagsExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…PromoterAvailable sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-L]
Plasmid#60741PurposeContains PIq driving expression RbsR-L, the Ribose inducible chimera with the wt Lac DBD.DepositorInsertRbsR-L
UseSynthetic BiologyTagsExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with RbsR L…PromoterAvailable sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
5mARF17 pBluescript
Plasmid#12069DepositorInsert5mARF17 (ARF17 Mustard Weed)
UseTagsExpressionBacterialMutationmiR160-resistant version of ARF17 has five silent…PromoterAvailable sinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAV10
Plasmid#63213PurposepUC19 backbone (Amp), contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. NotI or FseI sites for TU digest.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pPKm-292
Plasmid#105816PurposepcDNA - GAL4 DBD - MTAD. Expresses Gal4 DNA binding domain fused to MTADDepositorInsertGAL4 DBD and MTAD
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11
Plasmid#227332PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-hEPO
Plasmid#50436Purposeexpress human erythropoietin using lentiviral delivery systemDepositorInsertEPO (EPO Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA C12 ecDHFR DD YFP HA
Plasmid#192815PurposeExpresses an N-terminal enhanced destabilizing domain (DD) version of E. coli DHFR with higher basal turnover in mammalian systems. Contains missense mutations W74R/T113S/E120D/Q146L.DepositorInsertE. coli dihydrofolate reductase
UseTagsenhanced yellow fluorescent protein and hemagglut…ExpressionMammalianMutationW74R/T113S/E120D/Q146LPromoterCMVAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDule2-Mb haloTyrRS C6
Plasmid#160378PurposeC6 HaloTyrosine tRNA synthatase and cognate amber suppressing tRNA derived from M. barkeri.DepositorInsertC6 HaloTyrosine tRNA synthatase
UseSynthetic BiologyTagsExpressionBacterial and MammalianMutationL270S, Y271L, N311G, C313TPromoterAvailable sinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA RBM20
Plasmid#162735PurposeMammalian expressionDepositorInsertSpacer sequence for RBM20
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE7.10
Plasmid#102919Purposeexpresses ABE7.10 in mammalian cellsDepositorInsertABE7.10
UseTagsNLSExpressionMammalianMutationsee manuscriptPromoterCMVAvailable sinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
MGAT2-RpHLuorin2
Plasmid#171718PurposeCis-/medial-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to MGAT2 (MGAT2 Human)
UseTagsratiometric pHluorin2ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
GalT-RpHLuorin2
Plasmid#171719PurposeTrans-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to B4GALT1 (B4GALT1 Human)
UseTagsratiometric pHluorin2ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
aeBlue chromoprotein
Plasmid#117846PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses aeBlue chromoprotein in E. coliDepositorInsertpromoter, RBS, aeBlue
UseSynthetic Biology; Escherichia coliTagsExpressionMutationBioBrick sites removedPromoterAvailable sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
tsPurple chromoprotein
Plasmid#117848PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses tsPurple chromoprotein in E. coliDepositorInsertpromoter, RBS, tsPurple
UseSynthetic Biology; Escherichia coliTagsExpressionMutationBioBrick sites removedPromoterAvailable sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11
Plasmid#207758PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR4GN (Lenti)
Plasmid#222693PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsGFPExpressionMammalianMutationPGK without BsmBI cutsitePromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only