We narrowed to 18,818 results for: RAN-1
-
Plasmid#178372PurposeExpresses KSHV ORF 10 taggedDepositorInsertKSHV ORF 10
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0133
Plasmid#178394PurposeExpresses KSHV Downstream Mir-SYNDepositorInsertKSHV Downstream Mir-SYN
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0014
Plasmid#178384PurposeExpresses KSHV ORF 16 taggedDepositorInsertKSHV ORF 16
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0018R
Plasmid#178389PurposeExpresses KSHV ORF 47 taggedDepositorInsertKSHV ORF 47
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0020R
Plasmid#178391PurposeExpresses KSHV ORF 53 taggedDepositorInsertKSHV ORF 53
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0018
Plasmid#178388PurposeExpresses KSHV ORF 47 taggedDepositorInsertKSHV ORF 47
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0020
Plasmid#178390PurposeExpresses KSHV ORF 53 taggedDepositorInsertKSHV ORF 53
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0235M
Plasmid#178417PurposeKSHV Reverse compl Sequence Kaposincluster_RevCompl-KapATGdel_SynDepositorInsertReverseComplement-Kaposincluster_RevCompl_KapATGdel_Syn
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0016L
Plasmid#178387PurposeExpresses KSHV ORF45 tagged, double stopDepositorInsertKSHV ORF 45
UseLentiviralTags3xFLAGExpressionMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0133v2
Plasmid#178395PurposeExpresses KSHV downstream MIR-SYNDepositorInsertKSHV downstream MIR-SYN
UseRNAiTagsExpressionMutationPromoterAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD2KN0899
Plasmid#177092PurposeMoClo Level 2 plasmid containing multiple transcriptional units for transient expression of CrSTR, CrSLS, CrLAMT, CrTDC, and Cr7-DLH driven by 4x opaatBDepositorInsertCrSTR, CrSLS, CrLAMT, CrTDC, and Cr7-DLH
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD2KN0895
Plasmid#177091PurposeMoClo Level 2 plasmid containing multiple transcriptional units for transient expression of CrSTR, Cr7-DLH, CrLAMT, CrTDC, and CrSLS driven by 4x opaatBDepositorInsertCrSTR, Cr7-DLH, CrLAMT, CrTDC, and CrSLS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mdn1-deltaC
Plasmid#171603PurposeExpresses S. pombe Mdn1 a.a. 1-3911 in insect cells.DepositorInsertMdn1
UseTagsHis6 tagExpressionInsectMutationC-terminal deletion; a.a. 1-3911 onlyPromoterAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-10xQb oligo-library based
Plasmid#158201PurposeCassette of 10 different binding sites with high affinity to QB phage coat protein, as extracted from the oligo pool experiment.DepositorInsert10 binding sites of QB based on oligo library experiment
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPF_PLD
Plasmid#139113Purposeexpress prion like domain of hnRNPFDepositorInserthnRNPF (HNRNPF Human)
UseTagsExpressionBacterialMutation365-415PromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA6_DT1
Plasmid#136668PurposeExpresses human codon-optimized AcrIIA6 DT1 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA6_DT1
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA6_D1811
Plasmid#136667PurposeExpresses human codon-optimized AcrIIA6 D1811 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA6_D1811
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA6_D1024
Plasmid#136666PurposeExpresses human codon-optimized AcrIIA6 D1024 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA6_D1024
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA5_D4276
Plasmid#136664PurposeExpresses human codon-optimized AcrIIA5 D4276 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA5_D4276
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA5_D1126
Plasmid#136663PurposeExpresses human codon-optimized AcrIIA5 D1126 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA5_D1126
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAG_Ptet*_ToeRep_N01_switch
Plasmid#132737PurposeInducible expression of first-generation toehold repressor index 1 switch RNA with a GFP-ASV reporter via the Ptet* promoterDepositorInsertPtet*_ToeRep_N01_switch
UseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m5
Plasmid#84724PurposepVR2 but with an insertion of 1 U immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutationinsertion of 1 U between positions 39 and 40 of a…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA[DsxF].1026A
Plasmid#112690Purposeexpress gRNA targeting DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shTAF12.364
Plasmid#105572PurposeDox-inducible mir30 MYB shRNA/dsRED expression with GFP marker and neo resistanceDepositorInsertTAF12 shRNA
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterTREAvailable sinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-MYB-TAD(251-327)
Plasmid#105619Purposebacterially express GST tagged MYB TADDepositorInsertMYB-TAD domain (Myb Mouse)
UseTagsGSTExpressionBacterialMutationamino acids 251-327PromoterAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc'-EGL-44
Plasmid#66855PurposeExpress Myc-tagged C.elegans EGL-44 in mammalian cellsDepositorInsertEGL-44 (CELE_F28B12.2 Nematode)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Neurl1-TOPO
Plasmid#17281DepositorInsertNeuralized-like (Neurl1a Mouse)
UseTagsExpressionMutationPromoterAvailable sinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
HRE-dUnOHR
Plasmid#201714PurposeHypoxia responsive promoter driving UnaG and mOrangeDepositorInsertUnaG
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBA2kIKmA2
Plasmid#39213DepositorInsertKudzu Isoprene Synthase
UseSynthetic BiologyTagsExpressionMutationDeleted the predicted chloroplast transit peptidePromoterpsbA2Available sinceAug. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJUMP45-2A(sfGFP)
Plasmid#126989PurposeLevel 2 vector. sfGFP reporter. Origin RSF1010 (Broad-host-range)DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationNonePromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
GPI_2xmCherry
Plasmid#127812PurposeHomo-dimer mCherry-mCherry expression vector with plasma membrane localization signalDepositorInsertglycosylphosphatidylinositol-mCherry-mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSP64-Lifeact-GFP
Plasmid#135601PurposeExpression of Lifeact-GFP mRNA for microinjection for visualization of actin in S. purpuratusDepositorInsertLifeact-GFP
UseIn vitro transcription (mrna synthesis)TagsEGFPExpressionMutationPromoterUnknownAvailable sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
ROPY-2C2
Plasmid#128004PurposeLocal FRET-readout of membrane-anchored Stathmin/OP18 interaction with α-tubulinDepositorInsertROPY-2C2
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Or42a-Gal4
Plasmid#63032PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or42a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or42a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
SPL10p::pCGTAG (SPL10p::NLS-GFP)
Plasmid#27410DepositorInsertSPL10 promoter (AT1G27370 Mustard Weed)
UseTagsExpressionMutationSPL10 promoter transcriptionally fused to a nucle…PromoterAvailable sinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
Or85a-Gal4
Plasmid#63052PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or85a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or85a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or10a-Gal4
Plasmid#63020PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or10a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or10a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or22a-Gal4
Plasmid#63023PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or22a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or22a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-myc
Plasmid#185495PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsmycExpressionMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
35S-frGC155-MXMT-NosT
Plasmid#80172PurposeBiFC vector for transient expression of frGC155-MXMT in plantsDepositorInsertfrGFP(156-238)
UseTagsfrGC155ExpressionPlantMutationPromoterCaMV 35S promoterAvailable sinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
35S-psGC155-MXMT-NosT
Plasmid#80171PurposeBiFC vector for transient expression of psGC155-MXMT in plantsDepositorInsertpsGFP(156-238)
UseTagspsGC155ExpressionPlantMutationPromoterCaMV 35S promoterAvailable sinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
35S-sfGC155-MXMT-NosT
Plasmid#80166PurposeBiFC vector for transient expression of sfGC155-MXMT in plantsDepositorInsertsfGFP(156-238)
UseTagssfGC155ExpressionPlantMutationPromoterCaMV 35S promoterAvailable sinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Or92a-Gal4
Plasmid#63056PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or92a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or92a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or85f-Gal4
Plasmid#63054PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or85f, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or85f promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or42b-Gal4
Plasmid#63033PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or42b, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or42b promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or35a-Gal4
Plasmid#63031PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or35a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or35a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or13a-Gal4
Plasmid#63021PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or13a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or13a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or23a-Gal4
Plasmid#63025PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or23a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or23a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Or33a-Gal4
Plasmid#63028PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or33a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or33a promoter
UseTagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectMutationPromoterAvailable sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only