We narrowed to 8,869 results for: aav
-
Plasmid#229605PurposeExpresses mGreenLantern and mCherry in mammalian cellsDepositorInsertmGreenLantern
UseAAVExpressionMammalianAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-YAP5SA
Plasmid#223189PurposePlasmid containing the Zfr/YAP5SA cassette. Translation of YAP5SA is controlled by splicing modulation of the Zfr by risdiplam.DepositorInsertYAP5SA (Yap1 Mouse)
UseAAVTagsHA and engineered P2AMutationS61A, S109A, S127A, S164A, S381APromoterTNNT2Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K12(1)-U6-sgMap3K12(2)-hSyn1-mCherry
Plasmid#208835PurposeKnockout of Map3K12 (DLK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K13(2)-hSyn1-mCherry
Plasmid#208836PurposeKnockout of Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K12(1)-hSyn1-mCherry
Plasmid#208837PurposeKnockout of Map3K12 (DLK) and Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO(R285A)-NES
Plasmid#238919PurposeMammalian expression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-P2A-puro
Plasmid#192131PurposeExpresses Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9
UseAAVExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-503-WPRE
Plasmid#174133PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-503 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-427-WPRE
Plasmid#174135PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-427 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPROBE'-gfp[AAV]
Plasmid#40169DepositorInsertPromotor probe
Available SinceDec. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SYN1>Fas-Myc/Kir2.1*(E224G Y242F):P2A :dTomato
Plasmid#242233PurposeExpress Kir 2.1 and dTomato in the neuronsDepositorInsertsFas
Myc/Kir2.1 (E224GY242F)
UseAAV and Synthetic BiologyExpressionMammalianPromoterSYNAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15143 - pAAV-AiE0452h-minBG-SYFP2-P2A-mScarlet-10aa-H2B-WPRE3-BGHpA (Alias: CN5143)
Plasmid#224193PurposeAiE0452h is an enhancer sequence, designed to drive AAV-mediated transgene expression in striatal D2 MSNsDepositorInsertmScarlet-10aa-H2B
UseAAVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP15050 - pAAV-AiE1426m-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN5050)
Plasmid#224192PurposeAiE1426m is an enhancer sequence, designed to drive AAV-mediated transgene expression in striatal Sst_Chodl neuronsDepositorInsertSYFP2-P2A-3XFLAG-10aa-H2B
UseAAVAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1784 - pAAV SYN1 hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201820PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC
Plasmid#234547Purposeto express the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC
UseAAVMutationNonePromotermGFAP(ABC1D)Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-4-EF1a-LibVec
Plasmid#239600Purposeexpresses guide#4 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-3-EF1a-LibVec
Plasmid#239599Purposeexpresses guide#3 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-2-EF1a-LibVec
Plasmid#239598Purposeexpresses guide#2 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-1-EF1a-LibVec
Plasmid#239597Purposeexpresses guide#1 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13972 - pAAV-GfaABC1D-SYFP2-P2A-3XFLAG-10aa-H2B*-WPRE3-BGHpA (Alias: CN3972)
Plasmid#208159PurposeDirect-expressing SYFP2 in astrocytes AAV VirusDepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-PGC-1alpha-IRES-mCitrine
Plasmid#241791PurposeExpression vector for mouse Pgc-1alpha with mCitrineDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-pri-miR-Ctrl
Plasmid#235158PurposeExpresses EGFP and a control primary transcript in a Cre recombinase-dependent mannerDepositorInsertEGFP/primary transcript with control siRNA
UseAAVPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-miR-206-sponge
Plasmid#235154PurposeExpresses a EGFP-based sponge for miR-206 in a Cre recombinase-dependent mannerDepositorInsertEGFP/miR-206 sponge with 12x binding sites
UseAAVPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-miR-133-sponge
Plasmid#235155PurposeExpresses a EGFP-based sponge for miR-133 in a Cre recombinase-dependent mannerDepositorInsertEGFP/miR-133 sponge with 12x binding sites
UseAAVPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-pri-miR-137
Plasmid#235159PurposeExpresses EGFP and miR-137 primary transcript in a Cre recombinase-dependent mannerDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFPnls barcode-210-SV40 polyA
Plasmid#190876PurposeFor barcoded retrograde labelingDepositorInsertEGFPnls-barcode210
UseAAVMutationWTAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MPC026: pAAV-CAG-FLEX-NovArch-TS-Citrine_TSx3-ER2
Plasmid#153195Purposeencodes pAAV NovArchDepositorInsertNovArch
UseAAVTagscitrineExpressionMammalianAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP13798 - pAAV-DLX2.0-minBG-SYFP2-P2A-mScarlet-10aa-H2B-WPRE3-BGHpA (Alias: CN3798)
Plasmid#229935PurposeDLX2.0 is an enhancer sequence, designed to drive cytosolic SYFP2 and nuclear mScarlet expression in forebrain GABAergic neuronsDepositorInsertSYFP2-P2A-mScarlet-10aa-H2B
UseAAVAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG(del)-FLEx(loxP)-ARch3.0:EYFP
Plasmid#248667PurposeExpresses Archaerhodopsin3 tagged to eYFP in Cre-expressing cells under the CAG promoter for neuronal inhibition.DepositorInsertArch3.0-EYFP
UseAAVTagseYFPExpressionMammalianAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-feRMA-IRES-EGFP
Plasmid#248190PurposeExpresses Gluc-feRMA and EGFP under the hSyn promoter. Gluc-feRMA enables monitoring of neuronal transduction and includes a TEV cs, allowing inactivation of it upon interaction with TEV protease.DepositorInsertsGaussia luciferase with TEV cleavage site fused to IgG1 Fc
IRES-EGFP
UseAAV; LuciferaseTagsGluc (N terminal on insert) and IgG1 Fc (C termin…ExpressionMammalianPromoterIRES and hSynAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-Ace-mNeon2-WPRE
Plasmid#240056PurposeCre dependent Green fluorescent, negative response-polarity voltage indicator for mammalian expressionDepositorInsertAce-mNeon2
UseAAVPromoterEf1aAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-NHP.RMA-IRES-EGFP
Plasmid#227886PurposeExpresses Gluc-NHP.RMA and EGFP under the hSyn promoter. Gluc-NHP.RMA for monitoring neuronal transduction.DepositorInsertsGaussia luciferase fused to macaque Fc
IRES-EGFP
UseAAV and LuciferaseTagsGluc and IgG1 FcExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
Plasmid#223226PurposeguideRNA targeting the mouse Rev-erb alpha (Nr1d1)DepositorInsertNr1d1 (Nr1d1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA
Plasmid#206979PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertLmna sgRNA
UseAAV; Adenine base editorPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only