We narrowed to 7,298 results for: mCherry
-
Plasmid#183169PurposeConstruct for transient expression of Golgi apparatus-targeted mCherry in plants.DepositorInsertmCherry-Golgi
TagsAtRER1B, A. thaliana endoplasmic reticulum retrie…ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/Mito-mChe
Plasmid#183167PurposeConstruct for transient expression of mitochondrion-targeted mCherry in plants.DepositorInsertMito-mCherry
TagsOsCOX11, Oryza sativa cytochrome c oxidase assemb…ExpressionPlantAvailable SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shCTRL
Plasmid#181875PurposeExpresses a control shRNA with no known targets in the mouse genome under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertcontrol shRNA with no known targets in the mouse genome
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/mChe-Px
Plasmid#183170PurposeConstruct for transient expression of peroxisomes-targeted mCherry in plants.DepositorInsertmCherry-Px
Tags10 aa peroxisome targeting signal 1 (IHHPRELSRL) …ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/Pd-mChe
Plasmid#183172PurposeConstruct for transient expression of plasmodesmata-targeted mCherry in plants.DepositorInsertPd-mCherry
TagsAtPDCB1, A. thaliana PLASMODESMATA CALLOSE-BINDIN…ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/mChe-Cs
Plasmid#183171PurposeConstruct for transient expression of cytoskeleton-targeted mCherry in plants.DepositorInsertmCherry-Cs
Tags363 aa of A. thaliana FIMBRIN 1 (AtFIM1)ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/CF-mChe
Plasmid#183166PurposeConstruct for transient expression of cytoplasmic foci-targeted mCherry in plants.DepositorInsertCF-mCherry
TagsAtTZF1, A. thaliana TANDEM ZINC FINGER PROTEIN 1ExpressionPlantAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cry2PHR.mCh.CofS3E
Plasmid#133619PurposeExpresses Cry2PHR - mCherry - CofilinS3E protein fusionDepositorInsertCry2PHR - mCherry - CofilinS3E
ExpressionMammalianPromotercmvAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC240
Plasmid#118895Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for rec. protein with N-terminal MBP tag, cleavable with 3C and C-terminal mCherry, cleavable with TEV and HIS6, cleavable with 3CDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-TEV-mCherry-3C-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and mCherry, clea…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC71167
Plasmid#154066PurposeLevel 1 Position 3 Golden Gate vector, pL1M-R3-UbqP-Loxp-ER-Targ-mCherry-HDEL-Loxp-eGFPDepositorInsertZmUBI::lox-mCHERRY-lox-T35S-eGFP-TAct
UseSynthetic BiologyMutationAll BsaI, Esp3I and BPiI restriction sites were r…PromoterZea mays Ubiquitin PromoterAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLPC-mCh-ACTB-P2A-EGFP
Plasmid#165158PurposeExpresses an ACTB gene fragment with P2A, flanked by mCherry and EGFP, in Mammalian cellsDepositorInsertmCherry-ACTB-P2A-EGFP (ACTB Human)
UseRetroviralTagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKG123
Plasmid#63074PurposeRetroviral expression of mCherry-TEV-S-tag CENP-C for protein localization and affinity purification (LAP)DepositorAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUltra-hot-H2B-mTagBFP2
Plasmid#161792Purpose3rd generation lentiviral multicistronic vector for mammalian expression of mCherry, H2B-mTagBFP2, and one gene of interestDepositorInsertH2B-mTagBFP2
UseLentiviral; MulticistronicTagsmCherry and mTagBFP2ExpressionMammalianMutationI174A in the mTagBFP2 protein according to PLoS O…PromoterUbCAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYO1510
Plasmid#235739PurposeProtein expression of mCherry-14 x His in bacteriaDepositorArticleInsertmCherry
Tags14xHisExpressionBacterialAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Clim Act MCH (CAM)
Plasmid#104443PurposeExpresses mCherry under endogenous actin promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…PromoteractinAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim EF1 MCH (CEM)
Plasmid#104444PurposeExpresses mCherry under elongation factor 1 promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…PromoterEF1Available SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim Tub MCH (CTM)
Plasmid#104445PurposeExpresses mCherry under tubulin promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…Promotertubulin promoterAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2E2-HA-mCh
Plasmid#129596PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody variant-mCherry (2E2-HA scFv-mCherry)
ExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pM162
Plasmid#173221PurposeExpresses ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP(1-9)-GB1 and Puro-T2A-MCP-mCherry-GFP11-GB1DepositorInsertsScFV-GCN4-GFP10M2-GB1-T2A-OptGFP (1-10)-GB1
MCP-mCherry-GFP11-GB1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19/mChe-PM
Plasmid#183168PurposeConstruct for transient expression of plasma membrane-targeted mCherry in plants.DepositorInsertmCherry-PM
TagsOsRac3, O. sativa rac-like GTP-binding protein 3ExpressionPlantAvailable SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19/NLS-mChe
Plasmid#183162PurposeConstruct for transient expression of cell nucleus-targeted mCherry in plants.DepositorInsertNLS-mCherry
Tags16 aa nuclear localization signal and 16 aa nucl…ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/ER-mChe
Plasmid#183163PurposeConstruct for transient expression of endoplasmic reticulum-targeted mCherry in plants.DepositorInsertER-mCherry
Tags25 aa ER signal of Glycine soja kunitz-type tryps…ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS
Plasmid#216761PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS (700 pM) in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEND-304_Cacnes_tetR
Plasmid#225619PurposeC. acnes with tetR-based inducible expression of mCherry. pBRESP36A with P(PPA_RS09745)+RBS_2+TetR // P(BBa_23119-TetO1O3)+RBS_1+mCherryDepositorInsertTetR
UseSynthetic BiologyTags6xHis and mCherry-V5-6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-375_Cacnes_phlF
Plasmid#225620PurposeC. acnes with PhlF-based inducible expression of mCherry. pBRESP36A with P(PPA_RS09745)+RBS_2+PhlF // P(BBa_23119-PhlO1O3)+RBS_1+mCherry.DepositorInsertPhlF
UseSynthetic BiologyTags6xHis and mCherry-V5-6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only