We narrowed to 6,278 results for: tTA
-
Plasmid#235699PurposeControl plasmid expressing TVA and DsRed without G proteinDepositorInsertDsRedExpress, TVA800
UseRetroviralPromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
HSPB1
Plasmid#155670PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB09-TRE-beta-globin-miR-ctrl-EF1a-GFP
Plasmid#117319PurposeOverexpression of miR-124-surrounding locus (not miR-124) in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-CTRL
UseTransposon-mediated integrationTagsGFPExpressionMammalianMutationmiR-124 deletedPromoterTet-inducible promoterAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
GAPDH
Plasmid#155622PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S(rc)2_4_5-GFP
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6-sgH11-eCas9-T2A-BlastR
Plasmid#172492PurposeFor CRISPR-assisted HDR, Hipp11 locusDepositorInsert, BlastR and sgRNA targeting the Hipp11 (H11) safe harbor locus
UseCRISPR, Lentiviral, and Mouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-Positron2-ST-WPRE
Plasmid#239080PurposeAAV-mediated expression of positive-going voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequenceDepositorInsertPositron2-ST
UseAAV and Cre/LoxTagssoma localization targeting sequenceExpressionMammalianMutationR78K N81D D92N W178FPromoterhSynapsin1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
DRH002_scAAV-hSyn-delta_iCre-HA
Plasmid#225087PurposeExpression of inactive delta-iCre (control) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertdelta_iCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Mito-Car-GECO
Plasmid#100765PurposeLentiviral tet-inducible expression of mito-targeted genetically encoded Ca2+-indicators for optical imagingDepositorInsertLenti-Mito-Car-GECO
UseLentiviralTagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationR-GECO1: E163V/I166V/V174T/M176I/F222I/A302PPromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7
Plasmid#171848PurposepcDNA3-FLAG_FBXL7DepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CBh-Alb-mNG
Plasmid#183466PurposeTo produce AAV with the CBh promoter to express Alb(mouse)-mNeonGreen fusion proteinDepositorAvailable SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-WT Neo
Plasmid#223058PurposeMETTL1 gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:myr-Akt2_pISceI
Plasmid#231495PurposeExpresses myristolated Akt2 in zebrafish lymphoid and mesenchymal cellsDepositorAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)Bxb1
Plasmid#127511PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)phiC31
Plasmid#127510PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa2
Plasmid#138685PurposeExpresses a human AMPKa2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only