We narrowed to 12,099 results for: Vars
-
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQP-2376
Plasmid#138974PurposeLight-induced recruitment of NSImb-QPAS1-mCherry to the target protein bound to membrane; interaction occurs via intrabody fused to BphP1DepositorInsertNcoI-mVenus-CAAX-IRES2-BphP1- iB(GFP)- IRES2-NSImb-NES-mCh-Q-PAS1-NotI
Available SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIs8-4b-SaDAH::G226D
Plasmid#140130PurposeExpresses SaDAH::G226D variant with N-terminal 8xHis-tag in BL21 E. coliDepositorInsertDechloroacutumine halogenase G226D variant from Sinomenium acutum
Tags8x-His, TEV protease site (ENLYFQ)ExpressionBacterialMutationchanged Gly226 to Asp226PromoterT7Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYMH 539
Plasmid#138078PurposeControl vector with no degradation tag to compare against various degradation tag variantsDepositorInsertJ23104-mCherry::sbfI- pSEVA-331Bb
ExpressionBacterialAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-nolinker-GFP
Plasmid#108579PurposeExpresses PKAcs-GFP fusion in mammalian cellsDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-G12X-GFP
Plasmid#108588PurposeExpresses PKAcs-GFP fusion in mammalian cells with flexible linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
YORWΔ22Ω2
Plasmid#101705PurposeGoldenBraid vector pDGB2Ω2, adapted for S. cerevisiae genome integration by flanking the GB cassette with recombination arms of homology for integration at the YORWΔ22 solo LTR lociDepositorTypeEmpty backboneUseYeast expressionAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
YORWΔ22Ω1
Plasmid#101706PurposeGoldenBraid vector pDGB2Ω1, adapted for S. cerevisiae genome integration by flanking the GB cassette with recombination arms of homology for integration at the YORWΔ22 solo LTR lociDepositorTypeEmpty backboneUseYeast expressionAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
YORWΔ22α2
Plasmid#101707PurposeGoldenBraid vector pDGB2α2, adapted for S. cerevisiae genome integration by flanking the GB cassette with recombination arms of homology for integration at the YORWΔ22 solo LTR lociDepositorTypeEmpty backboneUseYeast expressionAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
YORWΔ22α1
Plasmid#101708PurposeGoldenBraid vector pDGB2α1, adapted for S. cerevisiae genome integration by flanking the GB cassette with recombination arms of homology for integration at the YORWΔ22 solo LTR lociDepositorTypeEmpty backboneUseYeast expressionAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
YPRCΔ15Ω2
Plasmid#101709PurposeGoldenBraid vector pDGB2Ω2, adapted for S. cerevisiae genome integration by flanking the GB cassette with recombination arms of homology for integration at the YPRCΔ15 solo LTR lociDepositorTypeEmpty backboneUseYeast expressionAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only