We narrowed to 4,301 results for: psin
-
Plasmid#213237PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only
-
F2RL1-DuET
Plasmid#213235PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D197, 199, 330, 332N IRES GFP
Plasmid#195703PurposeLentiviral plasmid encoding SYT9 with D197, 199, 330, 332N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-VP16
Plasmid#183927PurposeOptogenetic PHR domain coupled to GFP and VP16 activation domain; binds to CIBN upon blue light exposureDepositorExpressionMammalianMutationnonePromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph18_eGFP_CCR5TC
Plasmid#187443PurposeEncodes a specific PSD-95 binder (Xph18) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph18
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph15_eGFP_CCR5TC
Plasmid#187442PurposeEncodes a specific PSD-95 binder (Xph15) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph15
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-SspB (pBS1071)
Plasmid#185294PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I_47-300
ExpressionMammalianMutationD125IAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_mCh-SspB (pBS1145)
Plasmid#185327PurposeFor the mammalian expression of the human protein ApoE3_D125I attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I
ExpressionMammalianMutationD125IAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_mCh-SspB (pBS1143)
Plasmid#185325PurposeFor the mammalian expression of the human protein ApoE4 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-SspB (pBS1080)
Plasmid#185303PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-SspB (pBS1079)
Plasmid#185302PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-SspB (pBS1078)
Plasmid#185301PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_10
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only