We narrowed to 21,181 results for: ato
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-IFT38
Plasmid#218723PurposeExpresses N-terminally EGFP-tagged IFT38 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-ctfR1
Plasmid#207992PurposeCRISPR vector used with pAf-CRISPR-phoA (#207991) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertctfR1
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70DA7-DadR/DadS-Pdadh-DadhABC(A2)
Plasmid#191630PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strain with transcriptional regulators DadR/DadSDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadHR)-DadR-Pdadh-DadhABC(A2)
Plasmid#191645PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strain with transcriptional regulator DadRDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3delta4 GPR3-V5
Plasmid#172601PurposeLentiviral plasmid expressing c-terminal V5-tagged GPR3DepositorInsertG protein-Coupled Receptor 3 (GPR3 Human)
UseLentiviralTagsV5ExpressionMammalianMutationWTPromoterCMVAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_1.2μ-pcDNA3
Plasmid#111922PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_1.2μDepositorInsertCeNL(Ca2+)_1.2μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K855A
Plasmid#108298PurposepX459 V2.0 (Plasmid #62988) with the K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A
Plasmid#108297PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A+K855A
Plasmid#108299PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pMCh-1474
Plasmid#82420PurposePlasmid for expression of HA-tagged N-terminal region of Nematostella vectensis GW182 (aa 1-1158) in mammalian cellsDepositorInsertnvGW182 NED
TagsHAExpressionMammalianMutationdeleted amino acids 1159-1698 from nvGW182PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1475
Plasmid#82421PurposePlasmid for expression of HA-tagged C-terminal region of Nematostella vectensis GW182 (aa 1159-1698) in mammalian cellsDepositorInsertnvGW182 CED
TagsHAExpressionMammalianMutationdeleted amino acids 1-1158 from nvGW182PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1476
Plasmid#82422PurposePlasmid for expression of NHA-tagged N-terminal region of Nematostella vectensis GW182 (aa 1-1158) in mammalian cellsDepositorInsertnvGW182 NED
TagsNHAExpressionMammalianMutationdeleted amino acids 1159-1698 from nvGW182PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1477
Plasmid#82423PurposePlasmid for expression of NHA-tagged C-terminal region of Nematostella vectensis GW182 (aa 1159-1698) in mammalian cellsDepositorInsertnvGW182 CED
TagsNHAExpressionMammalianMutationdeleted amino acids 1-1158 from nvGW182PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only