We narrowed to 1,648 results for: CAG promoter
-
Plasmid#61168PurposeFluorescent reporter for nucleus NLS-mCherry-GUS expressed under AtUBQ10 promoterDepositorInsertNLS-mCherry-GUS
ExpressionPlantPromoterAtUBQ10Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMU-ACTFr
Plasmid#61191PurposeFluorescent reporter for F-actin AtFim-ABD2-mCherry expressed under AtUBQ10 promoterDepositorInsertAtFimbrin1-ABD
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceFeb. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMU-ACTLr
Plasmid#61193PurposeFluorescent reporter for F-actin LifeAct-mCherry expressed under AtUBQ10 promoterDepositorInsertLifeAct-mCherry
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMU-ERr
Plasmid#61170PurposeFluorescent reporter for endoplasmic reticulum AtWAK2sp-mCherry-HDEL expressed under AtUBQ10 promoterDepositorInsertAtWAK2-mCherry-HDEL
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceApril 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMU-PDESr
Plasmid#61206PurposeFluorescent reporter for plasmodesmata AtPDLP1-mCherry expressed under AtUBQ10 promoterDepositorInsertAtPDLP1
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMU-GAr
Plasmid#61172PurposeFluorescent reporter for Golgi apparatus GmMAN49-mCherry expressed under AtUBQ10 promoterDepositorInsertGmMAN49-mCherry
ExpressionPlantPromoterAtUBQ10Available SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMU-LEr
Plasmid#61185PurposeFluorescent reporter for late endosome mCherry-MtRAB5A2 expressed under AtUBQ10 promoterDepositorInsertMtRAB5A2
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMB-NUCr
Plasmid#61169PurposeFluorescent reporter for nucleus NLS-mCherry-GUS expressed under MtBCP1 promoterDepositorInsertNLS-mCherry-GUS
TagsmCherryExpressionPlantPromoterMtBCP1Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMB-TGN61r
Plasmid#61175PurposeFluorescent reporter for trans-Golgi network mCherry-MtSYP61 expressed under MtBCP1 promoterDepositorInsertMtSYP61
TagsmCherryExpressionPlantPromoterMtBCP1Available SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMB-ERr
Plasmid#61171PurposeFluorescent reporter for endoplasmic reticulum AtWAK2sp-mCherry-HDEL expressed under MtBCP1 promoterDepositorInsertAtWAK2-mCherry-HDEL
ExpressionPlantPromoterMtBCP1Available SinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMB-TMEr
Plasmid#61208PurposeFluorescent reporter for plasma membrane and peri-arbuscular membrane MtBCPsp-mCherry-BCP expressed under MtBCP1 promoterDepositorInsertMtBCPsp-mCherry-BCP
TagsmCherryExpressionPlantPromoterMtBCP1Available SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMB-TMEg
Plasmid#61209PurposeFluorescent reporter for plasma membrane and trunk peri-arbuscular membrane MtBCPsp-GFP-BCP expressed under MtBCP1 promoterDepositorInsertMtBCPsp-GFP-BCP
TagsEGFPExpressionPlantPromoterMtBCP1Available SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-B2M-miniGag-Cas9
Plasmid#228958PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-TRAC-miniGag-Cas9
Plasmid#228959PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIE324-ZF6x12-C DsRed-Express2 in TUPV1
Plasmid#201536PurposeDsRed-Express2 reporter regulated by ZF6 synTF promoter (12x compact binding sites) in TUPV1 for mMoClo golden gate-based assemblyDepositorInsertDsRed-Express2
ExpressionMammalianPromoterZF6x12(C)_YB_TATA Minimal PromoterAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-SpCas9D10A nickase
Plasmid#216736PurposeExpresses SpCas9-D10A nickase from a nEF promoter. For AAV packaging. Derived from pAAV-nEF-SpCas9 (Addgene #87115)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterEF-1-alpha coreAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/MtHp:nnLuz-I{PIV-216}:NosT
Plasmid#212192PurposeThis binary vector expresses mushroom luciferase (nnLuz) containing the PIV intron (216 bp into the gene) with the strong Medicago trunculata MtHP promoter and UTRDepositorInsertnnLuz-I{PIV-216}
ExpressionPlantMutationPIV intron added at bp 216, eliminates expression…PromoterMedicago trunculata MtHP promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPTXcGMPRELUC
Plasmid#68503Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with cGMPRE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation3x cGMPRE inserted 190bp 5' of ATG (cGMPRE =…PromoterOPTX promoter with cGMPREAvailable SinceSept. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
scAAV-hIBA1a-GFP
Plasmid#214146PurposeSelf-complementary AAV vector packaging GFP under the human Iba1 promoterDepositorInsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tTA
Plasmid#149363PurposeAAV-mediated and Cre-dependent expression of tTA under the CAG promoter.DepositorInserttTA2
UseAAV and Cre/LoxExpressionMammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18
Plasmid#68827PurposeExpresses c-myc-tagged human RAD18DepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GFP
Plasmid#11153PurposeMammalian expression vector for expression of GFP (CMV promoter)DepositorHas ServiceCloning Grade DNAInsertCMV promoter-EGFP
TagsEGFPExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCralbp-DsRed
Plasmid#11158DepositorAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
BLBP-mCherry
Plasmid#63721PurposeExpressing mCherry from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorInsertBLBP (Fabp7 Mouse)
ExpressionMammalianMutation1700 bp upstream of BLBP gene cloned in CAG-mCher…Promoter1700bp upstream of BLBP geneAvailable SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCKC764
Plasmid#226625PurposepiggyBAC pCAG-hCas9-T2A-Unbiased3DepositorInsertsCAG promoter, SpCas9, T2A, Unbiased3 variant of TdT (DNTT Human, S. pyogenes, Chicken)
EF1a promoter, blasticidin resistance
UseSynthetic BiologyExpressionMammalianPromoterCMV and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dSAP
Plasmid#68830PurposeExpresses c-myc-tagged human RAD18 deleting SAP domainDepositorInsertc-myc tagged human RAD18 deleting SAP domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 d6BD
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtBCP1Pro
Plasmid#159415PurposeMedicago truncatula BCP1 promoter sequence (1108 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtBCP1 Promoter
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only