We narrowed to 378 results for: tp53
-
Plasmid#97091PurposeEncodes a HR repair template that mutates the poly(A) signal as well as a few splicing factor binding sites of human NEAT1_1 isoform. Best used with px335-NEAT1_IS_v1 and v2 vectors.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only
-
-4200GAMT-P1-pGL4
Plasmid#26804DepositorInsertGuanidinoacetate N-methyltransferase (GAMT Human)
UseLuciferaseAvailable SinceJan. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
mCherry-BP1-2 pLPC-Puro
Plasmid#19835DepositorInsertFragment of p53-Binding Protein 1 (TP53BP1 Human)
UseRetroviralTagsmCherryMutationFragment of human 53BP1 aa 1220 - 1711Available SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
N-Myc-53BP1 WT pLPC-Puro
Plasmid#19836DepositorAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
N-Myc-53BP1 D1521A pLPC-Puro
Plasmid#19837DepositorInsertp53 Binding Protein 1 (TP53BP1 Human)
UseRetroviralTagsMycMutationchanged Asp1521 to AlaAvailable SinceMarch 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pET28C-mCherry-53BP1LCD
Plasmid#204407PurposeE. coli expression of the 53BP1 low-complexity domain (1208-1977) with an N-terminal mCherry tagDepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PVT1-luciferase
Plasmid#113350Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of PVT1 geneDepositorInsertPVT1-enhancer (PVT1 Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA5-eYFP-FKBP-MAD1-WT
Plasmid#114037PurposeChemical induction of MAD1 localisation to a specific site in the cell (by rapamycin & FRB)DepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMIA3-Keppel
Plasmid#214446PurposeExpresses eSpCas9 and gRNA targeting Keppel-19 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRExpressionMammalianPromoterEF1aAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIA3-Olônne
Plasmid#214447PurposeExpresses eSpCas9 and gRNA targeting Olônne-18 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRExpressionMammalianPromoterEF1aAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIA3-Pansio
Plasmid#214445PurposeExpresses eSpCas9 and gRNA targeting Pansio-1 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRExpressionMammalianPromoterEF1aAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Oct4deltaPE-53BP1mCherry
Plasmid#141122PurposeConstruct used to generate a transgenic mouse strain with expression of 53BP1-mCherry in embryonic germ cellsDepositorAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-53BP1
Plasmid#60813Purposemammalian expression vectorDepositorAvailable SinceDec. 9, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eYFP-FKBP-MAD1-AA
Plasmid#114038PurposeChemical induction of MAD1 localisation to a specific site in the cell (by rapamycin & FRB)DepositorInsertHuman MAD1 (MAD1L1 Human)
TagseYFP-FKBP12ExpressionMammalianMutationMAD2 binding deficient MAD1 K541A/L543APromoterCMVAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-LITAF
Plasmid#178444Purposedoxycycline-inducible expression of Human LITAF in mammalian cellsDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN130
Plasmid#91637PurposeExpress sgRNA targeting human MAD1L1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN131
Plasmid#91638PurposeExpress sgRNA targeting human MAD1L1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 WT
Plasmid#53446PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationsiRNA resistant and mutations A128V, T720A, A1347…Available SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits