We narrowed to 14,138 results for: eng
-
Plasmid#85760Purposemammalian expression of full length HA tagged USPL1DepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pBiex-1 Myosin VI HMM_SNAP
Plasmid#82716PurposeExpresses Myosin VI HMM with a C-terminal SNAP tag.DepositorInsertMyosin VI
Tags6xHis Tag, FLAG purification tag, and SNAP tagExpressionBacterial and InsectPromoterT7 PromoterAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSUPERIORpuro-shGAS5
Plasmid#46370DepositorAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
970 pBabe puroL PTEN R130G
Plasmid#10783DepositorAvailable SinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits only -
OA984-HA
Plasmid#120362PurposeExpresses a his-tagged single chain antibody 1C19 that targets all four DENV serotypes and expresses red fluorescent protein reporterDepositorInsert1C19 his-tagged single chain antibody
UseUnspecifiedPromoterAAEL010782 carboxypeptidase A (CPA) gene PromoterAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR4-V5/HIS
Plasmid#201109Purposeexpression of human FGFR4 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR4 receptor tyrosine kinase, full length, wildtype (FGFR4 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCMV-sct-p5-b2m-HLA-A0101
Plasmid#196512PurposeExpress single-chain peptide-MHC (CMV p5 epitope on HLA-A0101)DepositorInsertsingle chain of a CMV peptide, b2m and HLA A0101
UseLentiviralTagsNAExpressionMammalianMutationY84CPromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pES002 MBP-GSK3β_S9A-HA-His
Plasmid#196184PurposeExpresses MBP-GSK3β_S9A-HA-His (human Glycogen Synthase Kinase 3β S9A mutant as a fusion protein with MBP, HA, and His- tags) in E.coliDepositorInsertGSK3B (GSK3B Human)
TagsHA, His6, and MBPExpressionBacterialMutationchanged Serine 9 to AlaninePromoterTacAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCashGem-Xyl2-URA3-LINEAR
Plasmid#174840PurposepRS414 backbone containing LINEAR fragment targeting XYL2 in S. stipitisDepositorInsertCodon optimized Cas9:hGem
UseCRISPR and Synthetic BiologyTagshGeminin tagExpressionBacterial and YeastPromoterENO1pAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-INTS3-FL
Plasmid#128415PurposeExpress INTS3 full-length in E. coli with a GST tag (N-terminal)DepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-CCR5
Plasmid#98945PurposeMammalian expression plasmid for untagged human CCR5DepositorAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330A_D10A-1x6
Plasmid#58776PurposeExpresses Cas9 nickase and gRNADepositorInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRSET FLII275Pglu-4.6m
Plasmid#13565DepositorInsertFLIPglu F16A G275S-ECFP-K276R
TagsCitrineExpressionBacterialMutationF16A, ECFP insert in mglBAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22D
Plasmid#91136PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCT-L7.5.1
Plasmid#42900DepositorInsertL7.5.1
TagsHA and c-mycExpressionYeastPromoterGal1-10Available SinceJune 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-Ef1a-PP7 coat protein-Halo-GB1x3-WPRE
Plasmid#198337PurposePB plasmid expressing Halo-tagged PP7 coat proteinDepositorInsertPP7 coat protein 3x Halo-GB1
UsePiggybacTagsHaloTagExpressionMammalianPromoterEf1aAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver4.0
Plasmid#176543PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver4.0
Cas12f-GE ver4.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-YU2gp160
Plasmid#100927PurposeMammalian expression plasmid for Env from the YU-2 HIV-1 isolateDepositorInsertHIV-1 (YU2) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only