We narrowed to 13,990 results for: sgRNA
-
Plasmid#117560PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting Rpn2/Psmd1 subunit {AT2G32730} in A. thalianaDepositorInsertPromoter_AtU6-26 + sgRNA_Rpn2/Psmd1 subunit {AT2G32730} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0027
Plasmid#117558PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting AtADH gene gene in A. thaliana with 1 mismatch at PAMDepositorInsertPromoter_AtU6-26 + sgRNA_atADH1{At1G77120) _1mismatch in PAM A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL6 sgRNA(MS2)-MS2-hA3a D131E
Plasmid#112132Purposeempty sgRNA cloning vector with MS2-humanA3a D131EDepositorInserthuman Apobec3a D131E mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationD131E mutant in hA3aPromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH49
Plasmid#128211Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1a-LibVec
Plasmid#239591PurposeAAV vector for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pShCAST(Cas12k-TniQ)-sgRNA_entry (CJT11)
Plasmid#181787PurposeExpresses 3-component ShCAST containing a Cas12k-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShTnsB, ShTnsC, ShCas12k-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_4
Plasmid#217431PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only