We narrowed to 9,384 results for: tre promoter
-
Plasmid#203895PurposeDAT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertDAT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146490PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM2-RRM3-V5His6_H
Plasmid#146491PurposeInsect Expression of DmPABPC1-RRM2-RRM3DepositorInsertDmPABPC1-RRM2-RRM3 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM3-RRM4-V5His6_H
Plasmid#146492PurposeInsect Expression of DmPABPC1-RRM3-RRM4DepositorInsertDmPABPC1-RRM3-RRM4 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-V5His6_H
Plasmid#146499PurposeInsect Expression of DmGW182DepositorInsertDmGW182 (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146479PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_1-550-siRNAres_L
Plasmid#146859PurposeInsect Expression of DmPABPC1_1-550-siRNAresDepositorInsertDmPABPC1_1-550-siRNAres (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and six silent muta…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_90-635-siRNAres-V5His6_L
Plasmid#146860PurposeInsect Expression of DmPABPC1_90-635-siRNAresDepositorInsertDmPABPC1_90-635-siRNAres (pAbp Fly)
ExpressionInsectMutationfive silent mutations compared to the sequence gi…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-del91-164-V5His6_L
Plasmid#146861PurposeInsect Expression of DmPABPC1_del91-164DepositorInsertDmPABPC1_del91-164 (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and five silent mut…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-4H pET151
Plasmid#159386PurposeExpresses human TLNRD1 4-helix domain (residues 143-273) in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 (TLNRD1 Human)
Tagshis-tag, TEV cleavage siteExpressionBacterialMutationTLNRD1 4-helix domain (residues 143-273)PromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-Incenp d543-746iPRC1_279-482-GFP
Plasmid#108500Purposeinducible expression of vsv-INCENP d543-746iPRC1 279-482-EGFPDepositorInsertINCENP d543-746iPRC1 304-509 (PRC1 Human)
TagsEGFP and VSVExpressionMammalianMutationdelta alpha Helix, insert PRC1 microtubule domainPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-vsv-Incenp d543-746iPRC1_279-482-GFP
Plasmid#108504Purposeinducible expression of vsv-INCENP d543-746iPRC1 279-482-EGFPDepositorInsertINCENP d543-746iPRC1 304-509 (PRC1 Human)
TagsEGFP and VSVExpressionMammalianMutationdelta alpha Helix, insert PRC1 microtubule domainPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS415-GPD-PPK
Plasmid#183941PurposeExpresses E. coli PPK from yeast GPD promoterDepositorAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-VGF
Plasmid#107575PurposeEncodes the entire VGF cDNA sequence under the control of CMV promoter. Allows expression of VGF in mammalian cells.DepositorAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTJK438
Plasmid#138004Purpose3xMYC-SIX1 expression. Vector also expresses GFP under control of hUBC promoterDepositorAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-SCN8A-Variant-1-IRES-mScarlet
Plasmid#162280PurposeEukaryotic expression of human SCN8A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN8A Variant 1, stabilized (SCN8A Human)
TagsIRES-mScarletExpressionMammalianMutationModified human HSPA5 intron 4 inserted after bp23…PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-pphlO6-crtYBI
Plasmid#165977PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and 2,4-diacetylphloroglucinol in yeast expressing PhlTA and LuxTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only