We narrowed to 6,278 results for: tTA
-
Plasmid#249182PurposeExpress DCAF5(1-601) in Insect cellsDepositorInsertDCAF5(1-601) (DCAF5 Human)
TagsStrep_BirA_short-linker-TEVExpressionInsectMutationTruncation 1-601Available SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
Plasmid#245063PurposeAAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.DepositorInsertAAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry (Adra2a Mouse, Synthetic)
UseAAV, Cre/Lox, and RNAiPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP-TEV-Rat BCKDK-His
Plasmid#232119PurposeFor bacterial expression of His-tagged Rat BCKDK (AA31-412, missing precursor peptide) with a cleavable MBP purification tag.DepositorInsertBCKDK (Bckdk Rat)
Tags6 x His, Maltose-Binding Protein (MBP), and Tev S…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DRH016_ AAV-hSyn-DN-THR
Plasmid#225089PurposeExpression of dominant-negative thyroid receptor beta (THRB, human) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertDN-THRB (THRB Human)
UseAAVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del30)
Plasmid#166128PurposeExpression of human talin-1 head (residues 1-405) in E. coli. Contains 30 amino acid deletion in F1-loop. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-405(del30) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, with 30 amino acid deletion in th…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(T144E,T150E)
Plasmid#166130PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. Includes mutations T144E and T150E. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertHuT1head1-405(T144E,T150E) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, mutations T144E and T150EAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E1-dTom-nlsdTom
Plasmid#135637PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E1 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E3-dTom-nlsdTom
Plasmid#135638PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E3 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E4-dTom-nlsdTom
Plasmid#135639PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E4 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E7-dTom-nls-dTom
Plasmid#135642PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E7 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E9-dTom-nls-dTom
Plasmid#135644PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E9 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E10-dTom-nlsdTom
Plasmid#135645PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E10 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
OKSIM
Plasmid#24603DepositorUseCre/Lox and LentiviralExpressionMammalianMutationOct4-2A-KLF4-2A-Sox2-IRES-MycAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCM-CLYBL-hNIL
Plasmid#105841PurposeDonor construct for introduction of hNIL factors to CLYBL safe harbor site and iPSC differentiation to motor neuronDepositorInsertsUseCRISPR and TALENPromoterCAG, EF-1alpha, and TRE3GAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-RFP-NLS-CycB(1-266)_GFP-E2F1(1-230)_neo
Plasmid#73164Purposemulti-cistronic Vector for expression for Fly_FUCCI probes in insect cellsDepositorTagsmRFP1, GFPExpressionInsectMutationCyclin B Fragment aa 1-266 & E2F1 Fragment aa…Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyAvailable SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only