We narrowed to 11,816 results for: nts
-
Plasmid#13104DepositorInsertZF5
ExpressionMammalianAvailable SinceFeb. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pc3XB-ZF63
Plasmid#13199DepositorInsertZF63
ExpressionMammalianAvailable SinceOct. 31, 2006AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBJ5
Plasmid#167134PurposeA gentamycin resistant plasmid for Tn7-mediated chromosomal integration of Photorhabdus luminescens luxCDABE operon with Pfrr promoterDepositorInsertluxCDABE
UseLuciferaseExpressionBacterialPromoterFrr promoterAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJOG1368
Plasmid#167301PurposeLevel 0 module (CDS1) for further assemblies based on the Modular Cloning system. FCY-UPP gene conferring sensitivity to 5-FluorocytosineDepositorInsertFCY-UPP fusion gene
UseSynthetic Biology; Moclo level 0 vectorAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE667
Plasmid#153232PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pS24·Pm-GFP
Plasmid#122594PurposeExpresses GFP under the regulatory control of Pm. Expression needs additional xyls geneDepositorInsertPm promoter
UseSynthetic BiologyExpressionBacterialPromoterPmAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9CR5-NG
Plasmid#120228PurposepCas9CR5 with mutations to change PAM site specificity to NG from Nishimasu et al.DepositorInsertSpCas9-NG
UseSynthetic BiologyMutationMutations R1335V/L1111R/D1135V/G1218R/E1219F/A132…PromoterpTetAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CYP3A5_WT
Plasmid#81823PurposeGateway Donor vector containing CYP3A5 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p414ADH_Hsp82_CycTER
Plasmid#61712Purposeyeast plasmid with Hsp82DepositorAvailable SinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CTPSA
Plasmid#42343PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
BRAF in pENTR
Plasmid#216605Purposegateway cloning donor vector containing BRAFDepositorInsertBRAF (BRAF Human)
UseGateway CloningAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET-WT SpCas9-NLS-6xHis
Plasmid#207373PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertWT SpCas9
UseCRISPRTags6xHisExpressionBacterialPromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AL12R-HSP101
Plasmid#161014PurposePP7-tagged reporter driven by the Arabidopsis HSP101 promoterDepositorInsertPP7 and H2B-mScarlet
ExpressionPlantAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKD280
Plasmid#125071PurposeExpression of SO_4387 under PtacDepositorUseSynthetic BiologyExpressionBacterialMutationS286L- Please see depositor comments belowAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22D
Plasmid#91136PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only