We narrowed to 14,379 results for: Cre
-
Plasmid#250291PurposePiggyBac integration of 3 transcription factors (SPI1, CEBPA, FLI1) under a dox-inducible promoterDepositorInsertSPI1-T2A-CEBPA-P2A-FLI1
ExpressionMammalianAvailable sinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_CAG_OsTIR1_F74G_S210A
Plasmid#242189PurposeOsTIR1 variant S210A significantly enhances the overall degron efficiency, resulting in the degron system AID 2.1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCAG_OsTIR1_F74G_S210A
ExpressionMammalianMutationS210APromoterCAGAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#9 in pTwist-CMV backbone
Plasmid#216153PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells (brighter than #7). It uses a single intron. [Code 'B11']. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmScarlet with cryptic splice site and C-terminal FLAG tag
ExpressionMammalianAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP
Plasmid#67991PurposeCRISPR gRNA expression vector with an improved l scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with an improved scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLT 651
Plasmid#59998PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans klp-16/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorExpressionBacterialMutationpartial genomicAvailable sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NucCKAR
Plasmid#14869DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertC kinase activity reporter
TagsCFP, NLS, and YFPExpressionMammalianAvailable sinceAug. 9, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7-7 asyn G51D
Plasmid#105747PurposeBacterial expression of mutant human alpha synucleinDepositorAvailable sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSV-CaMKII
Plasmid#45064PurposeExpression of CaMKIIDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCaM Kinase II (Camk2a Rat)
ExpressionMammalianPromoterRSVAvailable sinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-DIO-mCherry-LATeNT
Plasmid#240992PurposeCre-dependent expression of LATeNTDepositorInsertmCherry-V5-LATeNT
UseAAVTagsV5 (internal)ExpressionMammalianAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Foxo1-ADA 6KQ
Plasmid#17563DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFoxo1 ADA 6KQ (Foxo1 Mouse)
TagsFlag and MycExpressionMammalianMutationK242, K245, K259, K262, K271 and K291 were replac…PromoterCMVAvailable sinceOct. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pT2SCb
Plasmid#59385PurposeTemplate plasmid for amplification of a selection cassette that includes two transcription terminator elements, an I-SceI site and a modified chloramphenicol resistance gene.DepositorPublicationInsertTT-ISceI-cat2
UseTemplateMutationThe 3’-end of the chloramphenicol resistance gene…Available sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DIO-NaChBac-dTomato
Plasmid#236252PurposeCre dependent NaChBac-TdTomato expressionDepositorInsertNaChBac-TdTomato
UseAAVTagsTdTomatoExpressionMammalianPromoterhSynAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCC_09 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dCas9-NLS-2A-Puro-WPRE
Plasmid#139094PurposeExpresses human codon-optimized inactive SpCas9 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840AAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.3 ss-3xFLAG-hLRP5 (aa 32-1615)
Plasmid#115788PurposeExpresses human LRP5 with N-terminal 3xflag tag in mammalian cells, contains artificial signal sequence upstream of tag.DepositorInsertLRP5 (LRP5 Human)
Tags3xflagExpressionMammalianMutationcontains silent mutation that creates an internal…PromoterCMVAvailable sinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Renilla_shRNAmir
Plasmid#178046PurposeCAG tdGFP Renilla shRNAmir cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertRenilla_713 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Luciferase_shRNAmir
Plasmid#178045PurposeCAG tdGFP Luciferase shRNAmir cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLuciferase_1309 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin C661S
Plasmid#118711PurposeLentiviral TET-ON inducible GFP-Progerin C661S (Farnesylation mutant)DepositorInsertGFP-Progerin C661S (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationC661S farnesylation mutantPromoterCMV TRE3G (TET-ON)Available sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4
Plasmid#170849PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only