We narrowed to 4,725 results for: GCA
-
Plasmid#136583PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailabilityAcademic Institutions and Nonprofits only
-
pPN458
Plasmid#137876PurposePiggyBac vector for expression of 1x gRNA targeting TCF4 for CRISPRa;mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GenEPi
Plasmid#140236PurposeMammalian expression of Piezo1-based fluorescent force sensor GenEPiDepositorInsertGenEPi (Piezo1-based fluorescent force sensor) (PIEZO1 Human)
TagsGCaMP 6s RS1 EF4ExpressionMammalianPromotersimian CMV IE94Available SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAK-1
Plasmid#210131Purposeknock out BAK in mammalian cellsDepositorInsertBcl-2 homologous antagonist/killer (BAK1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hTRPV4-C-GC6s
Plasmid#154150PurposeTo detect the calcium ion releases from TRPV4 channelDepositorAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shSTING-Hsa
Plasmid#128158PurposeDoxycyclin inducible shRNA knockdown of human STING geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCYFIP1-2
Plasmid#210138Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDK2 gRNA (BRDN0001148866)
Plasmid#77191Purpose3rd generation lentiviral gRNA plasmid targeting human CDK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_pegRNA_(PP7-C4-Q1)
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only