We narrowed to 9,384 results for: tre promoter
-
Plasmid#108444PurposeArabidopsis transformation, expresses HDT2 promoter/GUS fusion to study expression pattern in rootsDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pMIR-Report-SPRED1-3'UTR (containing miR-21 sites)
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-hPIKfyve
Plasmid#121148PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.DepositorInsert1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 (PIKFYVE Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a-MICB*005-IRES-ZsGreen
Plasmid#114008PurposeInduces expression of human MICB allele 005 cDNADepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
yeast_DualReporter
Plasmid#127546PurposeA dual reporter vector modified from Sharon et al (Nature Biotech, 2012) containing Ura3 and Nat1 selectable markers, a constant background RFP (TEF2::mCherry), and a variable YFP (pTpA+MCS::yEVenus).DepositorInsertsUseSynthetic BiologyExpressionYeastPromoterTEF, TEF2, URA3, bla (E. coli), and pTpA+MCSAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL2del
Plasmid#216742PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 2 (OL2) by examining the variant lacking OL2 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [LEDSGYMA…Available SinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL4del
Plasmid#216744PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 4 (OL4) by examining the variant lacking OL4 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 4 (OL4) with the sequence of [TLDGKPVQ…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL5del
Plasmid#216745PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 5 (OL5) by examining the variant lacking OL5 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 5 (OL5) with the sequence of [ATFAA] i…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL1del
Plasmid#216741PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 1 (OL1) by examining the variant lacking OL1 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 1 (OL1) with the sequence of [INIGGALQ…Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1213 - pL0_p16OMT (pro + 5U)
Plasmid#203890Purpose16OMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsert16OMT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1214 - pL0_pNMT (pro + 5U)
Plasmid#203893PurposeNMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertNMT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆sap-NLS-3XFLAG-V5
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆rrm-NLS-3XFLAG-V5
Plasmid#196093PurposeExpresses mouse SAFB lacking the rrm domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 428-506 (RRM) of mouse SAFB p…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-ATOH1 (SA Substitutions)
Plasmid#172309PurposeIn vitro transcription of ATOH1 (Ser phosphosites substituted by Ala)DepositorAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
Plasmid#122959PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xmyc tagMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only