We narrowed to 41,838 results for: LAT;
-
Plasmid#92228PurposeExpression of zmADH using the p70a promoter and UTR1DepositorInsertNTerm 6xHis Tagged zmADH
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70aAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACVR1B-bio-His
Plasmid#51640PurposeExpresses full-length Activin receptor type 1B precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertACVR1B (ACVR1B Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
VIPR1
Plasmid#51865PurposeExpresses full-length Vasoactive intestinal polypeptide receptor 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertVIPR1 (VIPR1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Dll1ICD-HPC4 pBacPAK8-3
Plasmid#17333DepositorAvailable SinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBabe EGFR Del2
Plasmid#32065DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
RBM38
Plasmid#155899PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Substance P-pHluorin IRES mRuby3
Plasmid#195699PurposeLentiviral plasmid encoding first 68 residues of mouse preprotachykinin with a C-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-siResist
Plasmid#49852PurposeEncodes human connexin 43 with wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationContains several wobble mutations to confer resis…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-cytoBirA-2a-mCherry
Plasmid#79885PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S454A
Plasmid#19844DepositorInsertMKL1 S454A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Serine 454 to AlanineAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
SCUBE1-bio-His
Plasmid#53415PurposeExpresses full-length Signal peptide, CUB and EGF-like domain-containing protein 1 ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSCUBE1 (SCUBE1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
F11-R pEBio
Plasmid#61486PurposeExpresses full-length F11R (JAM1) ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag and biotinylation sequenceDepositorInsertF11R (F11R Human)
Tagsenzymatic biotinylation sequence and rat CD4 d3+4ExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoNMM:mCherry
Plasmid#111878PurposeThis plasmid expresses mCherry fluorescent protein fused to an N-Myristoylation motif (NMM) from the endogenous Src2 gene (CAOG_06360). It can be used to visualize the membrane and filopodia.DepositorInsertCapsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
B4GALT1-Dox
Plasmid#124633PurposeDoxycycline-inducible B4GALT1 expression in mammalian cellsDepositorInsertsBeta-(1,4)-Galactosyltransferase 1
Tetracycline repressor A3 mutant
TagFP635
ExpressionMammalianPromoterTRE-tight and hEF1aAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1 S449A/T450A/S454A
Plasmid#19847DepositorInsertMKL1 S449A/T450A/S454A (MRTFA Human)
UseRetroviralTags3xFLAGMutationchanged Serine 449, Threonine 450 and Serine 454 …Available SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMT-MCS-cytoBirA-2A-mCherry_Ras
Plasmid#80058PurposeMCS for cloning promoter to drive HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1Gh
Plasmid#44507DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFS_1061_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_GGC(BbsI)-Leader-ARRAY2-DR2-FaqI_Term_NotI
Plasmid#184738Purposeencodes aTc inducible FsRT-Cas1–Cas2 and transcriptionally insulated FsCRISPR Array 2DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
ExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-SOCS6-WT
Plasmid#74496PurposeOverexpression of SOCS6 in mammalian cellsDepositorAvailable SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only