We narrowed to 4,091 results for: plasmid lenti crispr
-
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS
Plasmid#60904PurposeThe plasmid encodes a antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a transcriptional activation domain VP64DepositorInsertscFv-GCN4
UseLentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2 Cryptic PE-Max
Plasmid#216163PurposeExpression of prime editor PEMax (Plasmid #174820) only in cells with TDP-43 loss of function. Note: It is not recommended to produce lentivirus containing TDP-REG sequences – see Depositor CommentsDepositorInsertPEMax for prime editing with internal cryptic exon
UseCRISPRExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiCRISPRv2
Pooled Library#73179PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiCRISPRv2
Pooled Library#73632PurposeMouse sgRNA library in backbone lentiCRISPRv2 containing 78,637 unique sgRNAs targeting 19,674 genes along with 1000 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Plasmid#107311PurposeEncoding scFv-p65-HSF1 driven by EF1α promoterDepositorInsertEF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
UseLentiviralExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_LacZ_sgRNA
Plasmid#155108Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_eZ3_Gal4VP64
Plasmid#169917PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch3 core with an additional EGF repeat, and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianMutationAdditional EGF repeat between the extracellular d…PromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only